The CCA-end of P-tRNA Contacts Both the Human RPL36AL and the A-site Bound Translation Termination Factor eRF1 at the Peptidyl Transferase Center of the Human 80S Ribosome

Abstract

We have demonstrated previously that the E-site specific protein RPL36AL present in human ribosomes can be crosslinked with the CCA-end of a P-tRNA in situ. Here we report the following: (i) We modeled RPL36AL into the structure of the archaeal ortholog RPL44E extracted from the known X-ray structure of the 50S subunit of Haloarcula marismortui. Superimposing the obtained RPL36AL structure with that of P/E tRNA observed in eukaryotic 80S ribosomes suggested that RPL36AL might in addition to its CCA neighbourhood interact with the inner site of the tRNA elbow similar to an interaction pattern known from tRNA•synthetase pairs. (ii) Accordingly, we detected that the isolated recombinant protein RPL36AL can form a tight binary complex with deacylated tRNA, and even tRNA fragments truncated at their CCA end showed a high affinity in the nanomolar range supporting a strong interaction outside the CCA end. (iii) We constructed programmed 80S complexes containing the termination factor eRF1 (stop codon UAA at the A-site) and a 2’,3’-dialdehyde tRNA (tRNAox) analog at the P-site. Surprisingly, we observed a crosslinked ternary complex containing the tRNA, eRF1 and RPL36AL crosslinked both to the aldehyde groups of tRNAox at the 2’- and 3’-positions of the ultimate A. We also demonstrated that, upon binding to the ribosomal A-site, eRF1 induces an alternative conformation of the ribosome and/or the tRNA, leading to a novel crosslink of tRNAox to another large-subunit ribosomal protein (namely L37) rather than to RPL36AL, both ribosomal proteins being labeled in a mutually exclusive fashion. Since the human 80S ribosome in complex with P-site bound tRNAox and A-site bound eRF1 corresponds to the post-termination state of the ribosome, the results represent the first biochemical evidence for the positioning of the CCA-arm of the P-tRNA in close proximity to both RPL36AL and eRF1 at the end of the translation process.

Chemical footprinting reveals conformational changes of 18S and 28S rRNAs at different steps of translation termination on the human ribosome

“…Protection patterns in the PTC ring observed in complex 6 (containing eRF1•eRF3•GMPPNP and deacylated tRNA at the P site) might be caused by displacement of eRF1 toward the PTC, facilitated by the lack of the peptidyl moiety in the P site-bound tRNA. Remarkably, the location of eRF1 close to the PTC in complex 6 is consistent with the data on cross-linking of the P site-bound periodate-oxidized tRNA to eRF1 in the analogous ribosomal complex containing eRF1•eRF3•GMPPNP (Hountondji et al 2014). This crosslinking also takes place in complexes similar to those 7 and 8.…”

“…This crosslinking also takes place in complexes similar to those 7 and 8. It has been supposed (Hountondji et al 2014) that in all these complexes tRNA could adopt both P/P and P/E configurations and that tRNA in the P/P state is involved in the cross-linking with eRF1, whereas tRNA in the P/E state is cross-linked to the ribosomal protein eL44 (eL36AL). On the contrary, peptidyl-tRNA occupying the P site of the pretermination complex seemed to prevent eRF1 bound to eRF3 and GMPPNP from extending to the PTC and contacting the PTC ring (Taylor et al 2012).…”

Untitled

“…Interestingly, the Lys-53 residue of the GGQTK motif was shown to play an essential role in peptide bond formation. Moreover, the Lys-53 residue has a pKa value of 6.9 [21] which is 3.5 units less than that of a normal lysyl residue (pKa = 10.53). Therefore, the Lys-53 residue located at the catalytic site is likely to be deprotonated at physiological pH, giving the possibility of a nucleophilic attack of nitrogen on the nearby electrophilic group.…”

“…citral-4-phenyl-3-thiosemicarbazone (UCK-36) piperitone-4-phenylthiosemicarbazone (UCK-37), the benzoin-4-phenylthiosemicarbazone (UCK-159) and 4-chlorobenzophenone-4-phenylthiosemicarbazone (UCK-160) can be explained by the fact that the molecules mask the NH 2 group of the side chain of Lys-53 which reacts with an aldehyde group of tRNAox to form a Schiff base. Lys-53 is adjacent to the GGQ motif conserved in the eL42 of all eukaryotic 80S ribosomes [21]. This motif is identical to the universally conserved GGQ motif common for all class-1 translation termination factors responsible for stop codon recognition and for triggering hydrolysis of the P sitebound peptidyl-tRNA [22].…”

A Functional Role for the Monomethylated Gln-51 and Lys-53 Residues of the 49GGQTK53 Motif of eL42 from Human 80S Ribosomes

“…A 5’ coding region of human eL42 (formerly RPL36A) was PCR amplified from pColdI-RPL36A [23] using a 5’ primer GCTCGGTACCCTCGAGGGATCC of pColdI, and a 3’primer CCTTTTTCCGGAAAATCGGATAGCCACT CTGCTTCC corresponding to a region of eL42 deleted of residues 49-GGQTK-53 respectively containing the Xho I and Bsp EI restriction sites (underlined). The digested Xho I– Bsp EI purified PCR fragment was then cloned in the corresponding sites of pColdI-RPL36A as a replacement of the wild type sequence leading to pcoldI-RPL36A(∆ GGQTK).…”