The Compensatory G88R Change Is Essential in Restoring the Normal Functions of Influenza A/WSN/33 Virus Matrix Protein 1 with a Disrupted Nuclear Localization Signal

Xie, Hang; Lin, Zhengshi; Mosier, Philip D.; Desai, Umesh R.; Gao, Yamei

doi:10.1128/jvi.02024-12

Cited by 8 publications

(26 citation statements)

References 34 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“… [12] . Xie et al, using computational protein–protein docking techniques along with the 1EA2 structure, have also proposed a model in which adjacent M1 N 1–165 domains may be stacked against one another so as to maximize the electrostatic interaction of the NLS region and nearby basic residues with a cluster of negatively-charged residues of the opposite M1 face and also the M1–M1 steric interactions [10] . This model may be more representative of M1 in its biological environment because it relies only on electrostatic and shape complementarity rather than crystal packing forces to obtain tetrameric structures.…”

Section: Resultsmentioning

confidence: 99%

“…The N-terminal domain (1–165 aa) of M1 was subcloned into pET30b (Novagen) from a pHW2000 plasmid expressing the full-length A/WSN/33 M1 [10] at the cloning sites of Nde1+Xho1. The new plasmid pET30b-M1wt-1–165 with a His-tag at the N-terminus (5′-primer: actagccatatgcaccatcatcatcatcatagtcttctaaccgaggtc; 3′-primer: tctgatctcgagctacatttgcctatgagaccgatg) was expressed in E. coli strain Nico21(DE3) (NEB).…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Crystal Structures of Influenza A Virus Matrix Protein M1: Variations on a Theme

et al. 2014

Self Cite

View full text Add to dashboard Cite

Matrix protein 1 (M1) of the influenza A virus plays multiple roles in virion assembly and infection. Interest in the pH dependence of M1's multiple functions led us to study the effect of subtle pH changes on M1 structure, resulting in the elucidation of a unique low-pH crystal structure of the N1-165-domain of A/WSN/33 (H1N1) M1 that has never been reported. Although the 2.2 Å crystal structure of M1 N-terminus shows a dimer with the two monomers interacting in a face-to-face fashion at low pH as observed earlier, a 44° rotation of the second monomer has led to a significantly different dimer interface that possibly affects dimer stability. More importantly, while one of the monomers is fully defined, the N-terminal half of the second monomer shows considerable disorder that appears inherent in the protein and is potentially physiologically relevant. Such disorder has not been observed in any other previously reported structure at either low or high pH conditions, despite similar crystallization pH conditions. By comparing our novel N1-165-domain structure with other low-pH or neutral-pH M1 structures, it appears that M1 can energetically access different monomer and dimer conformations, as well as oligomeric states, with varying degree of similarities. The study reported here provides further insights into M1 oligomerization that may be essential for viral propagation and infectivity.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Crystal Structures of Influenza A Virus Matrix Protein M1: Variations on a Theme

et al. 2014

Self Cite

View full text Add to dashboard Cite

show abstract

“… 30 As a result, M(NLS-88R) not only has a thick M1 layer in assembled virions but also replicates efficiently in vitro and in vivo , similar to the parent virus WSN. 30 , 31 In contrast, M(NLS-88E) has a thin M1 layer in mature virions and replicates inefficiently in vitro and in vivo . 30 Using M(NLS-88R) and M(NLS-88E) as model viruses, we revealed that the transition from a face-to-back orientation at neutral pH to a face-to-face orientation at acidic pH allows M1 to quickly dissociate from vRNP for efficient replication.…”

Section: Introductionmentioning

confidence: 95%

“…Both M(NLS-88R) and M(NLS-88E) are M1 mutants in the WSN background that differ in a single mutation at M1 position 88 (G88R vs G88E). 30 G88R but not G88E was originally acquired by the virus as a spontaneous compensatory mutation after NLS disruption. 30 As a result, M(NLS-88R) not only has a thick M1 layer in assembled virions but also replicates efficiently in vitro and in vivo , similar to the parent virus WSN.…”

Section: Introductionmentioning

confidence: 99%

“… 30 G88R but not G88E was originally acquired by the virus as a spontaneous compensatory mutation after NLS disruption. 30 As a result, M(NLS-88R) not only has a thick M1 layer in assembled virions but also replicates efficiently in vitro and in vivo , similar to the parent virus WSN. 30 , 31 In contrast, M(NLS-88E) has a thin M1 layer in mature virions and replicates inefficiently in vitro and in vivo .…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Maintaining pH-dependent conformational flexibility of M1 is critical for efficient influenza A virus replication

Chiang

Musayev

Košíková

et al. 2017

Emerging Microbes & Infections

Self Cite

View full text Add to dashboard Cite

The M gene segment of influenza A virus has been shown to be a contributing factor to the high growth phenotype. However, it remains largely unknown why matrix protein 1 (M1), the major structural protein encoded by M gene, exhibits pH-dependent conformational changes during virus replication. Understanding the mechanisms underlying efficient virus replication can help to develop strategies not only to combat influenza infections but also to improve vaccine supplies. M(NLS-88R) and M(NLS-88E) are two M1 mutants differing by only a single amino acid: G88R vs G88E. G88R but not G88E was the compensatory mutation naturally selected by the virus after its nuclear localization signal was disrupted. Our study shows that, compared with M(NLS-88E) M1, M(NLS-88R) M1 dissociated quickly from viral ribonucleoproteins (vRNPs) at higher pH and took less time to dissemble in vitro, despite forming thicker matrix layer and having stronger association with vRNP in assembled virions. Correspondingly, M(NLS-88R) replicated more efficiently and was genetically more stable than M(NLS-88E). Crystallographic analysis indicated that M(NLS-88R) M1, like wild-type M1, is able to switch from a face-to-back-oriented conformation to a face-to-face-oriented conformation when pH drops from neutral to acidic, whereas G88E mutation causes M(NLS-88E) M1 to be trapped in a face-to-face-arranged conformation regardless of environmental pH. Our results suggest that maintaining M1 pH-dependent conformational flexibility is critical for efficient virus replication, and position 88 is a key residue controlling M1 pH-dependent conformational changes. Our findings provide insights into developing M1-based antiviral agents.

show abstract

Conformational triggers associated with influenza matrix protein 1 polymerization

Mohd-Kipli

Claridge

Habjanič

et al. 2021

Journal of Biological Chemistry

View full text Add to dashboard Cite

A central role for the influenza matrix protein 1 (M1) is to form a polymeric coat on the inner leaflet of the host membrane that ultimately provides shape and stability to the virion. M1 polymerizes upon binding membranes, but triggers for conversion of M1 from a water-soluble component of the nucleus and cytosol into an oligomer at the membrane surface are unknown. While full-length M1 is required for virus viability, the N-terminal domain (M1NT) retains membrane binding and pH-dependent oligomerization. We studied the structural plasticity and oligomerization of M1NT in solution using NMR spectroscopy. We show that the isolated domain can be induced by sterol-containing compounds to undergo a conformational change and self-associate in a pH-dependent manner consistent with the stacked dimer oligomeric interface. Surface-exposed residues at one of the stacked dimer interfaces are most sensitive to sterols. Several perturbed residues are at the interface between the N-terminal subdomains and are also perturbed by changes in pH. The effects of sterols appear to be indirect and most likely mediated by reduction in water activity. The local changes are centered on strictly conserved residues and consistent with a priming of the N-terminal domain for polymerization. We hypothesize that M1NT is sensitive to changes in the aqueous environment and that this sensitivity is part of a mechanism for restricting polymerization to the membrane surface. Structural models combined with information from chemical shift perturbations indicate mechanisms by which conformational changes can be transmitted from one polymerization interface to the other.

show abstract

The Compensatory G88R Change Is Essential in Restoring the Normal Functions of Influenza A/WSN/33 Virus Matrix Protein 1 with a Disrupted Nuclear Localization Signal

Cited by 8 publications

References 34 publications

Crystal Structures of Influenza A Virus Matrix Protein M1: Variations on a Theme

Crystal Structures of Influenza A Virus Matrix Protein M1: Variations on a Theme

Maintaining pH-dependent conformational flexibility of M1 is critical for efficient influenza A virus replication

Conformational triggers associated with influenza matrix protein 1 polymerization

Contact Info

Product

Resources

About