The complete sequence and structural analysis of human apolipoprotein B-100: relationship between apoB-100 and apoB-48 forms.

Abstract

We have isolated and sequenced overlapping cDNA clones covering the entire sequence of human apolipoprotein B‐100 (apoB‐100). DNA sequence analysis and determination of the mRNA transcription initiation site by S1 nuclease mapping showed that the apoB mRNA consists of 14,112 nucleotides including the 5′ and 3′ untranslated regions which are 128 and 301 nucleotides respectively. The DNA‐derived protein sequence shows that apoB‐100 is 513,000 daltons and contains 4560 amino acids including a 24‐amino‐acid‐long signal peptide. The mol. wt of apoB‐100 implies that there is one apoB molecule per LDL particle. Computer analysis of the predicted secondary structure of the protein showed that some of the potential alpha helical and beta sheet structures are amphipathic, whereas others have non‐amphipathic neutral to apolar character. These latter regions may contribute to the formation of the lipid‐binding domains of apoB‐100. The protein contains 25 cysteines and 20 potential N‐glycosylation sites. The majority of cysteines are distributed in the amino terminal portion of the protein. Four of the potential glycosylation sites are in predicted beta turn structures and may represent true glycosylation positions. ApoB lacks the tandem repeats which are characteristic of other apolipoproteins. The mean hydrophobicity the mean value of H1 and helical hydrophobic moment the mean value of microH profiles of apoB showed the presence of several potential helical regions with strong polar character and high hydrophobic moment. The region with the highest hydrophobic moment, between amino acid residues 3352 and 3369, contains five closely spaced, positively charged residues, and has sequence homology to the LDL receptor binding site of apoE. This region is flanked by three neighbouring regions with positively charged amino acids and high hydrophobic moment that are located between residues 3174 and 3681. One or more of these closely spaced apoB sequences may be involved in the formation of the LDL receptor‐binding domain of apoB‐100. Blotting analysis of intestinal RNA and hybridization of the blots with carboxy apoB cDNA probes produced a single 15‐kb hybridization band whereas hybridization with amino terminal probes produced two hybridization bands of 15 and 8 kb. Our data indicate that both forms of apoB mRNA contain common sequences which extend from the amino terminal of apoB‐100 to the vicinity of nucleotide residue 6300. These two messages may have resulted from differential splicing of the same primary apoB mRNA transcript.

Structure of apolipoprotein B-100 of human low density lipoproteins.

“…In our direct peptide sequencing work, we observed both V and A at residue 3849, while the amino acid deduced from our cDNA sequence 5 is A, and that deduced from the other four published DNA sequences is V. In our cDNA sequencing work, 5 we observed in some clones the same three-codon deletion in the signal peptide region (codons -1 6 to -14) as that observed by Cladaras et al, 9 and we observed both ATT (I) and CTT (L) at codon 618 (refers to the codon number in the mature peptide region) and both CCT (P) and GCT (A) at codon 892. Some of the sequence variations have also been detected as restriction fragment polymorphisms in population studies.…”

“…However, in some cases, there is circumstantial evidence that suggests sequencing errors. At codon 766, Law et al 8 observed CGA, whereas all other authors observed CAG; at codon 1391, Cladaras et al 9 observed TCT, whereas all others observed TTC; at codon 2298, Hardman et al 50 observed TAT, whereas all others observed ATT; at codon 2906, Law et al 8 observed TCG, whereas all others observed TGC; at codon 3264, Carlson et al 51 observed CTG, whereas all others observed CGT; at codon 3404, Law et al 8 observed CCG, whereas all others observed GCC; and at codon 3797, Cladaras et al 9 observed CGA, whereas all others observed CAG. In each of these cases, the differences involve the rearrangement of two or three nucleotides, a situation that is unlikely to have arisen by point mutation.…”

“…Reference Chen et al 5 Knott et al°L aw et al 8 Cladaras et al 9 Ludwig et al 40 Carlson et al 53 Hardman et al 52 Protter et al M Chen et al …”

Glycated LDL Concentrations in Non-Diabetic and Diabetic Subjects Measured with Monoclonal Antibodies Reactive with Glycated Apolipoprotein B Epitopes

“…Apolipoprotein B is a complex macromolecule that exists in two primary forms in human plasma (30,31), and it is the protein determinant for the cellular recognition and uptake of LDL by the LDL receptor (32)(33)(34)(35). The binding of apolipoprotein B to the LDL receptor results in internalization and degradation of LDL, promoting the clearance of LDL from the plasma and regulating intracellular cholesterol handling and biosynthesis (36)(37)(38).…”

Mutation in Apolipoprotein B Associated with Hypobetalipoproteinemia Despite Decreased Binding to the Low Density Lipoprotein Receptor

“…Detection of Mutations-The R3480P mutation was caused by the substitution of cytosine for guanine at position 10,648 in complementary DNA, in exon 26 of the APOB gene on chromosome 2p24 (15,16). DNA from each of the 13,427 individuals was subjected to PCR (forward primer, 5ЈGAAAGCCTCACCTCTTACTTTTCCATTGAG3Ј, and reverse primer, 5ЈGAAATCCCATAAGCTCTTGTCATAGACCGG3Ј) with an annealing temperature of 65°C followed by digestion with MspI.…”