The Conjugative DNA Translocase TrwB Is a Structure-specific DNA-binding Protein

Abstract

TrwB is a DNA-dependent ATPase involved in DNA transport during bacterial conjugation. The protein presents structural similarity to hexameric molecular motors such as F 1 -ATPase, FtsK, or ring helicases, suggesting that TrwB also operates as a motor, using energy released from ATP hydrolysis to pump single-stranded DNA through its central channel. In this work, we have carried out an extensive analysis with various DNA substrates to determine the preferred substrate for TrwB. Oligonucleotides with G-rich sequences forming G4 DNA structures were the optimal substrates for TrwB ATPase activity. The protein bound with 100-fold higher affinity to G4 DNA than to single-stranded DNA of the same sequence. Moreover, TrwB formed oligomeric protein complexes only with oligonucleotides presenting such a G-quadruplex DNA structure, consistent with stoichiometry of six TrwB monomers to G4 DNA, as demonstrated by gel filtration chromatography and analytical ultracentrifugation experiments. A protein-DNA complex was also formed with unstructured oligonucleotides, but the molecular mass corresponded to one monomer protein bound to one oligonucleotide molecule. Sequences capable of forming G-quadruplex structures are widespread through genomes and are thought to play a biological function in transcriptional regulation. They form stable structures that can obstruct DNA replication, requiring the action of specific helicases to resolve them. Nevertheless, TrwB displayed no G4 DNA unwinding activity. These observations are discussed in terms of a possible role for TrwB in recognizing G-quadruplex structures as loading sites on the DNA.Bacterial plasmids are key players in bacterial evolution. Not only do they participate in the slow processes of speciation that shape bacterial genomes, but they also mediate the much more rapid and medically important processes of dissemination of antibiotic resistance and bacterial virulence (1). Among the three classical mechanisms of horizontal gene transfer (conjugation, transformation, and transduction), conjugation is undoubtedly the most salient, at least in many human pathogens, from Gram-negative Enterobacteriaceae and Pseudomonas to Gram-positive Enterococcus, to cite just three examples. Bacterial conjugative systems contain an essential integral membrane protein called the Type IV coupling protein (T4CP). This protein is involved in DNA transport, coupling the relaxosome (a DNA-protein complex) to the secretion channel (a multiprotein complex that spans the inner and outer membranes of the donor cell) (2, 3). TrwB, the T4CP of conjugative plasmid R388, is a DNA-dependent ATPase (4). It is a member of the FtsK/SpoIII family of DNA translocases (5, 6). The crystallographic structure of TrwB⌬N70, the cytoplasmic domain of TrwB, reveals a hexamer with a six-fold symmetry and a central channel of about 20 Å in diameter (7). The structural similarity between TrwB and well known molecular motors, such as F 1 -ATPase (8) or T7 gene 4 helicase (9), suggests that TrwB also operates as a motor, u...

The All-Alpha Domains of Coupling Proteins from the Agrobacterium tumefaciens VirB/VirD4 and Enterococcus faecalis pCF10-Encoded Type IV Secretion Systems Confer Specificity to Binding of Cognate DNA Substrates

“…4). Interestingly, an earlier study showed that the TrwB R388 receptor preferentially binds potential G-quadruplex (G4) DNA sequences and also that G4 DNA stimulates TrwB R388 ATPase activity to a greater extent than other DNA sequences (58,59). These findings, coupled with the results of the present studies and additional observations discussed below, support a proposal that AAD binding of DNA is not required for substrate docking per se but nevertheless plays an important role in activation of the T4CP as a prerequisite for subsequent substrate transfer through the T4SS channel.…”

Functional Interactions of VirB11 Traffic ATPases with VirB4 and VirD4 Molecular Motors in Type IV Secretion Systems

“…The atomic structure of the C-terminal domain of the VirB4 homolog in Thermoanaerobacter pseudethanolicus was recently obtained (17), revealing a striking structural similarity with TrwB, the VirD4 homolog of the R388 plasmid. TrwB was extensively characterized as a DNA-dependent ATPase (6,18), playing an essential role in connecting the relaxosome complex with the secretion channel. The structural similarity between TrwB and well-known molecular motors, such as F 1 ATPase or ring helicases, suggests that TrwB uses the energy released from ATP hydrolysis to pump DNA through its central channel (19).…”

Recognition of intermolecular G‐quadruplexes by full length nucleophosmin. Effect of a leukaemia‐associated mutation

“…To know whether NPM can also recognize intermolecular Gquadruplexes, we have explored its interaction with a DNA sequence (''G4tetra''), as a model of tetrameric, but not intramolecular G4 [18]. When mixtures of NPM and G4tetra were analyzed by SEC (Fig.…”

“…For some experiments, the DNA samples were resuspended without KCl and/or not subjected to annealing. Oligo G4tetra (5 0 -TCGCCACGTTTCGCCGTTTGCGGG GGTTTCTGCGAGGAACTTTGG) [18] (from Sigma-Aldrich) was annealed as described in Ref. [18].…”