The conserved 18,000-molecular-weight outer membrane protein of Haemophilus ducreyi has homology to PAL

Abstract

Haemophilus ducreyi expresses an 18,000-molecular-weight outer membrane protein that contains a conserved surface-exposed epitope recognized by monoclonal antibody 3B9. Monoclonal antibody 3B9 cross-reacts with proteins of similar molecular weight found in many Haemophilus sp. strains, including P6, a candidate vaccine for Haemophilus influenzae. The gene encoding the 18,000-molecular-weight outer membrane protein was identified by screening a gt11 genomic library with 3B9. The coding sequence of the gene was localized to a 471-bp open reading frame, designated pal (peptidoglycan-associated lipoprotein). Translation of pal predicted a mature polypeptide with a molecular weight of 15,000 that had extensive homology with P6 and Escherichia coli PAL. The predicted signal peptide had features characteristic of a prokaryotic lipoprotein, and processing of PAL was sensitive to globomycin in H. ducreyi. The sequences encoding mature H. ducreyi PAL were subcloned into the vector pRSET B and expressed as a polyhistidine-containing fusion protein that bound 3B9. In Western blot (immunoblot) analysis, serum samples obtained from healthy subjects and patients with chancroid or other genital ulcer diseases contained antibodies to purified PAL. Antibodies that bound to PAL were removed by absorption with a lysate of Haemophilus sp. antigens, suggesting that patients with chancroid do not develop an H. ducreyi-specific antibody response to PAL.

Expression of Peptidoglycan-Associated Lipoprotein Is Required for Virulence in the Human Model of Haemophilus ducreyi Infection

“…Antibodies. MAb 3B9 was described previously (47). The preparation of polyclonal rabbit antisera to H. ducreyi whole cells and recombinant PAL is described elsewhere (24).…”

“…Construction of an isogenic pal mutant in the H. ducreyi 35000HP background. The plasmid pHD18pal:mTn3(Cm) contains a 4.3-kb insert, which includes a 1.5-kb chloramphenicol acetyltransferase gene (cat) cassette located in the pal open reading frame (ORF) (44,46,47). The plasmid pRSM1791 utilizes lacZ as a counterselectable marker to facilitate allele exchange (12).…”

“…Complementation of H. ducreyi 35000HP-SMS4. Sequences including the pal promoter region, ORF, and transcriptional terminator were amplified using the 5Ј primer CCGTTTCAAAGCTAACTTGCCAG and the 3Ј primer TTGGGC TTATCTAACCGCTTAGC, which correspond to bp 18 through 40 and bp 648 through 670 of the published pal sequence (47). A NotI linker was included in the 5Ј primer.…”

“…We recently characterized several H. ducreyi lipoproteins (25,46,47), one of which is the 18-kDa PAL. H. ducreyi PAL contains a conserved, surface-exposed epitope defined by monoclonal antibody (MAb) 3B9 (46).…”

“…P6, a target of serum bactericidal antibodies, is being intensively studied as a candidate for a vaccine to prevent nontypeable H. influenzae infections, particularly otitis media (9,24,36). We made a recombinant nonlipidated form of H. ducreyi PAL and generated anti-PAL sera in rabbits (47). Low percentages of survival were obtained by incubation of H. ducreyi in 50% anti-PAL serum and active complement, but no killing occurred in higher dilutions of this serum (24).…”