The crucial role of Erk2 in demyelinating inflammation in the central nervous system

Abstract

BackgroundBrain inflammation is a crucial component of demyelinating diseases such as multiple sclerosis. Although the initiation of inflammatory processes by the production of cytokines and chemokines by immune cells is well characterized, the processes of inflammatory aggravation of demyelinating diseases remain obscure. Here, we examined the contribution of Erk2, one of the isoforms of the extracellular signal-regulated kinase, to demyelinating inflammation.MethodsWe used the cuprizone-induced demyelinating mouse model. To examine the role of Erk2, we used Nestin-cre-driven Erk2-deficient mice. We also established primary culture of microglia or astrocytes in order to reveal the crosstalk between two cell types and to determine the downstream cascades of Erk2 in astrocytes.ResultsFirst, we found that Erk is especially activated in astrocytes within the corpus callosum before the peak of demyelination (at 4 weeks after the start of cuprizone feeding). Then, we found that in our model, genetic ablation of Erk2 from neural cells markedly preserved myelin structure and motor function as measured by the rota-rod test. While the initial activation of microglia was not altered in Erk2-deficient mice, these mice showed reduced expression of inflammatory mediators at 3–4 model weeks. Furthermore, the subsequent inflammatory glial responses, characterized by accumulation of microglia and reactive astrocytes, were significantly attenuated in Erk2-deficient mice. These data indicate that Erk2 in astrocytes is involved in augmentation of inflammation and gliosis. We also found that activated, cultured microglia could induce Erk2 activation in cultured astrocytes and subsequent production of inflammatory mediators such as Ccl-2.ConclusionsOur results suggest that Erk2 activation in astrocytes plays a crucial role in aggravating demyelinating inflammation by inducing inflammatory mediators and gliosis. Thus, therapies targeting Erk2 function in glial cells may be a promising approach to the treatment of distinct demyelinating diseases.

Functional antagonism of sphingosine‐1‐phosphate receptor 1 prevents cuprizone‐induced demyelination

“…In contrast, selective inhibition of NFjB activation in astrocytes through transgenic overexpression of a dominant negative IjBa under the control of GFAP promoter was sufficient to protect against cuprizone-induced loss of myelin and associated inflammatory responses whereas inhibition of NFjB in oligodendrocytes had no effect (Raasch et al, 2011). We found that phosphorylation of ERK1/2 in astrocytes at sites of oligodendrocyte damage was prevented by S1PR1 antagonism (Figure 7), in line with a recent study that demonstrated that ablation of Erk2 in the CNS reduced the levels of immune mediators, gliosis and demyelination in the cuprizone model (Okazaki et al, 2016). Consistent with the critical role of astrocytes in toxin induced demyelination, forced over-activation of astrocytic Nrf2, a main transcriptional regulator for the anti-oxidative defense system, through GFAP-specific deletion of the Nrf2 repressor Keap1, ameliorates the cuprizone-induced loss of oligodendrocytes and inflammation (Draheim et al, 2016).…”

The pleiotropic effects of prebiotic galacto-oligosaccharides on the aging gut

“…Total nucleic acid was subsequently quantified and normalized to 1 ng/μl prior to qPCR setup. qPCR reactions were performed using the Power-SYBR Green Master Mix, 3 ng of total nucleic acid per reaction, and the following primer pairs (at a final concentration of 100 nM): TNFa (Fwd: 5′-ACGGCATGGA TCTCAAAGAC-3′, Rev: 5′-GTGGGTGAGGAGCACG TAGT-3′) [129], IL-6 (Fwd: 5′-CTGCAAGAGACTTC CATCCAGTT-3′, Rev: 5′-GAAGTAGGGAAGGCCG TGG-3′) [130], GapDH (Fwd: 5′-TGCACCACCACCAA CTGCTTAG-3′, Rev: 5′-GGATGCAGGGATGATGTT C-3′) [131], Muc2 (Fwd: 5′-GCTGACGAGTGGTTGG TGAATG-3′, Rev: 5′-GATGAGGTGGCAGACAGG AGAC-3′) [132], RELMβ (Fwd: 5′-CCATTTCCTG AGCTTTCTGG-3′, Rev: 5′-AGCACATCCAGTGACA ACCA-3′) [133], and TFF3 (Fwd: 5′-CAGATTACGT TGGCCTGTCTCC-3′, Rev: 5′-ATGCTTGCTACCCT TGGACCAC-3′) [133]. qPCR reactions were performed on the QuantStudio Q6 instrument (Thermo Fisher Scientific, Waltham, MA).…”

Murine induced pluripotent stem cell‐derived neuroimmune cell culture models emphasize opposite immune‐effector functions of interleukin 13‐primed microglia and macrophages in terms of neuroimmune toxicity

“…Melt curves were performed upon completion of the cycles to confirm specificity of the product amplification. The following primer sequences were used: Arg1 ‐FOR 5′‐AGGGTTACGGCCGGTGGAGAG‐3′, Arg1 ‐REV 5′‐CCTCAGTGCTGCAGGGCCTTT‐3′ (Guglielmetti et al, 2016); YM1 ‐FOR 5′‐CAGGTCTGGCAATTCTTCTGAA, YM1 ‐REV 5′‐GTCTTGCTCATGTGTGTAAGTGA‐3′ (Guglielmetti et al, 2016); iNOS ‐FOR 5′‐CAGCTGGGCTGTACAAACCTT‐3′, iNOS ‐REV 5′‐CATTGGAAGTGAAGCGTTTCG‐3′ (Guglielmetti et al, 2016); TNFα ‐FOR 5′‐ACGGCATGGATCTCAAAGAC‐3′, TNFα ‐REV 5′‐AGATAGCCAAATCGGCTGACG‐3′ (Okazaki et al, 2016); peptidylprolyl isomerase A ( ppiA )‐FOR 5′‐CAGACGCCACTGTCGCTTT‐3′, ppiA ‐REV 5′‐TGTCTTTGGAACTTTGTCTGCAA‐3′ (Luyckx, Everaert, et al, 2018). The mRNA expression levels of Arg1 , YM1 , iNOS , and TNFα were normalized to ppiA mRNA expression level.…”