The crystal structure of the naturally split gp41‐1 intein guides the engineering of orthogonal split inteins from <i>cis</i>‐splicing inteins

Beyer, Hannes M.; Mikula, Kornelia M.; Li, Mi; Wlodawer, Alexander; Iwaï, Hideo

doi:10.1111/febs.15113

Cited by 19 publications

(18 citation statements)

References 65 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The GP41-1 split intein, which was identified from environmental metagenomic sequence data 9 , was chosen for use in the SIMPL system due to its small size (88 amino acids long in IN and 37 amino acids long in IC) and because it possesses the most rapid reaction rate among all split inteins examined 7,10,11 .…”

Section: Resultsmentioning

confidence: 99%

Split Intein-Mediated Protein Ligation for detecting protein-protein interactions and their inhibition

et al. 2020

View full text Add to dashboard Cite

Here, to overcome many limitations accompanying current available methods to detect protein-protein interactions (PPIs), we develop a live cell method called Split Intein-Mediated Protein Ligation (SIMPL). In this approach, bait and prey proteins are respectively fused to an intein N-terminal fragment (IN) and C-terminal fragment (IC) derived from a re-engineered split intein GP41-1. The bait/prey binding reconstitutes the intein, which splices the bait and prey peptides into a single intact protein that can be detected by regular protein detection methods such as Western blot analysis and ELISA, serving as readouts of PPIs. The method is robust and can be applied not only in mammalian cell lines but in animal models such as C. elegans. SIMPL demonstrates high sensitivity and specificity, and enables exploration of PPIs in different cellular compartments and tracking of kinetic interactions. Additionally, we establish a SIMPL ELISA platform that enables high-throughput screening of PPIs and their inhibitors.

show abstract

Section: Resultsmentioning

confidence: 99%

Split Intein-Mediated Protein Ligation for detecting protein-protein interactions and their inhibition

et al. 2020

View full text Add to dashboard Cite

show abstract

“…The nucleophile-histidine-acid catalytic triad motif of serine/cysteine proteases is located at the interface of the two β-barrels and considered to be the result of convergent evolution. Even though the common horseshoe-like fold of the HINT superfamily members does not have two distinct β-barrels, the HINT fold contains two subdomains related by the pseudo-C2-related symmetry [10,22,30,38]. This symmetry relation may also be the result of gene duplication, fusion, and loop-swapping events [10,37].…”

Section: Discussionmentioning

confidence: 99%

“…We assumed that introducing the unique WCT motif found in class 3 inteins into a class 1 intein together with the first Cys/Ser to Ala mutation could possibly result in a functional cis-splicing intein if they were closely related by a divergently evolved lineage, similar to class 2 and BIL domains. We chose the class 1 gp41-1 intein as a template intein because gp41-1 intein has a Thr residue at the corresponding position of the WCT motif of class 3 inteins, and the 1.0 Å-resolution crystal structure (6qaz) is available, facilitating the WCT motif engineering [30]. We introduced the WCT motif on the gp41-1 intein based on the amino-acid sequence alignment ( Figure 3a and Supplemental Figure S1a).…”

Section: Conversion Of a Class 1 Intein Into A Class 3 Inteinmentioning

confidence: 99%

The Convergence of the Hedgehog/Intein Fold in Different Protein Splicing Mechanisms

Beyer

Virtanen

Aranko

et al. 2020

IJMS

Self Cite

View full text Add to dashboard Cite

Protein splicing catalyzed by inteins utilizes many different combinations of amino-acid types at active sites. Inteins have been classified into three classes based on their characteristic sequences. We investigated the structural basis of the protein splicing mechanism of class 3 inteins by determining crystal structures of variants of a class 3 intein from Mycobacterium chimaera and molecular dynamics simulations, which suggested that the class 3 intein utilizes a different splicing mechanism from that of class 1 and 2 inteins. The class 3 intein uses a bond cleavage strategy reminiscent of proteases but share the same Hedgehog/INTein (HINT) fold of other intein classes. Engineering of class 3 inteins from a class 1 intein indicated that a class 3 intein would unlikely evolve directly from a class 1 or 2 intein. The HINT fold appears as structural and functional solution for trans-peptidyl and trans-esterification reactions commonly exploited by diverse mechanisms using different combinations of amino-acid types for the active-site residues.

show abstract

“…Grafting the unique WCT motif found in class 3 inteins to a class 1 intein with the first Cys/Ser to Ala mutation could result in a functional cis-splicing intein if they were related by a divergently evolved lineage. We chose the class 1 gp41-1 intein as a model because it already has Thr at the position corresponding to the WCT motif of class 3 inteins and the 1.0 Å-resolution crystal structure is available, facilitating the WCT motif engineering 29 . We grafted the WCT motif to the gp41-1 intein based on the amino-acid sequence alignment ( Fig.…”

Section: Conversion Of a Class 1 Intein Into A Class 3 Inteinmentioning

confidence: 99%

“…The PCR products were ligated into BamHI and HindIII-digestedpHYRSF53 43 , resulting in pHBRSF073 (MchDnaB1_HN) and pHBRSF074 (MchDnaB1_HAA) for the bacterial expression of N-terminally hexahistidine-tagged SUMOfused MchDnaB1 intein variants.The C1A, F65W, and D107C mutations were introduced into the gp41-1 intein coding sequence via assembly PCR from plasmid pBHDuet37 29 using the oligonucleotides HB019: 5attaching the 3-residue N-and C-terminal junction sequences. The assembled PCR product was ligated into pBHDuet3729 using the BamHI and KpnI restriction sites, resulting in plasmid pHBDuet024 for cis-splicing tests. Variants encoding only the F65W and D107C mutations (pHBDuet023) were generated the same way, but using HB013: 5'-CAAAACCTACACCGTAACGGAAGGATCCGGCTATTGCCTGGATCTGAAAACGCA GGTG instead of HB019.…”

mentioning

confidence: 99%

Convergent evolution of the Hedgehog/Intein fold in protein splicing

Beyer

Virtanen

Aranko

et al. 2020

Preprint

Self Cite

View full text Add to dashboard Cite

Abbreviations: CBD, chitin-binding domain; BI, branched intermediate; BIL, Bacterial Intein-Like; HINT, Hedgehog/INTein; Hh-C, the C-terminal domain of the Hedgehog protein or hog protein; IMAC, immobilized metal affinity chromatography; IPTG, isopropyl-β-D-thiogalactoside; MchDnaB1 intein, DnaB1 intein from Mycobacterium chimaera; PDB, Protein Data Bank; r.m.s.d., root-mean-square deviation; PEG, polyethylene glycol; PMSF, phenylmethane sulfonyl fluoride; DTT, dithiothreitol AbstractThe widely used molecular evolutionary clock assumes the divergent evolution of proteins.Convergent evolution has been proposed only for small protein elements but not for an entire protein fold. We investigated the structural basis of the protein splicing mechanism by class 3 inteins, which is distinct from class 1 and 2 inteins. We gathered structural and mechanistic evidence supporting the notion that the Hedgehog/INTein (HINT) superfamily fold, commonly found in protein splicing and related phenomena, could be an example of convergent evolution of an entire protein fold. We propose that the HINT fold is a structural and biochemical solution for trans-peptidyl and trans-esterification reactions. IntroductionProteins fold into various defined three-dimensional structures to exert their unique biochemical functions. Proteins with similar structures and functions across different organisms share common ancestors and have evolved through divergent evolution 1 . However, protein structures could also converge into a similar structure to function analogously but having evolved from different ancestors. This convergent evolution is best exemplified by the catalytic Ser-His-Asp triad commonly found in hydrolases, suggesting the importance of structural and functional constraints required for catalysis 2,3,4 . Even though convergent evolution is a commonly observed phenomenon across the diversity of living organisms, the convergent evolution of protein structures has been documented for only small structural elements of proteins 5 .Structural convergence of an entire protein fold has not been reported 6 .Protein splicing catalyzed by intervening protein sequences termed inteins was discovered in the 1990s. The splicing reaction involves the self-removal of the intein and concomitant joining of the two flanking sequences (exteins) 7,8 . Protein splicing is analogous to RNA splicing but occurs on the protein level. The biological function of protein splicing is still enigmatic despite several proposals for eventual regulatory functions 9 . Inteins are often considered merely as selfish gene elements because they can be removed without affecting the fitness of their host organisms. Inteins commonly insert in conserved sequences close to the active sites of essential proteins. Any mutations within inteins detrimental to the protein splicing could be lethal or strongly affect the fitness of their host, which is the mechanism ensuring intein persistence and protection from degeneration.The most common protein splicing mechanism has been generall...

show abstract

The crystal structure of the naturally split gp41‐1 intein guides the engineering of orthogonal split inteins from cis‐splicing inteins

Cited by 19 publications

References 65 publications

Split Intein-Mediated Protein Ligation for detecting protein-protein interactions and their inhibition

Split Intein-Mediated Protein Ligation for detecting protein-protein interactions and their inhibition

The Convergence of the Hedgehog/Intein Fold in Different Protein Splicing Mechanisms

Convergent evolution of the Hedgehog/Intein fold in protein splicing

Contact Info

Product

Resources

About