The CXXC motifs in the metal binding domains are required for ATP7B to mediate resistance to cisplatin

Safaei, Roohangiz; Adams, Preston L.; Maktabi, Mohammad H.; Mathews, Ryan A.; Howell, Stephen B.

doi:10.1016/j.jinorgbio.2012.02.016

Cited by 47 publications

(55 citation statements)

References 50 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…[2] It has been demonstrated that, similarly to Cu, Pt binds to the CXXC motifs of the NMBDs of ATP7B and that such interaction mediates cancer cell resistance to cisplatin. [3,4] Recently, the SSM technique was employed to investigate charge movements (Cu + ) in recombinant human Cu-ATPases. [5][6][7] Addition of ATP to microsomes enriched with recombinant ATP7A/B and adsorbed on a SSM is followed by an electrogenic event recorded as a current transient (see Figure 1 and Supporting Methods).…”

mentioning

confidence: 99%

Translocation of Platinum Anticancer Drugs by Human Copper ATPases ATP7A and ATP7B

et al. 2013

View full text Add to dashboard Cite

Cisplatin, carboplatin, and oxaliplatin are widely used anticancer drugs. Their efficacy is strongly reduced by development of cell resistance, a phenomenon not entirely understood, with contribution of drug detoxification, defective accumulation, and efflux from the cell. Downregulation of CTR1, responsible for Cu uptake by the cell, and up-regulation of the Cu-ATPases, ATP7A and ATP7B, which accept Cu from the cytosolic chaperone Atox1 and transfer the metal ion into the secretory pathway where it is incorporated into cuproenzymes, have been associated to augmented drug resistance. To gain information on translocation of Pt drugs by human CuATPases, we performed electrical measurements on COS-1 cell microsomal fraction, enriched with recombinant ATP7A, ATP7B, and selected mutants, adsorbed on a solid supported

show abstract

mentioning

confidence: 99%

Translocation of Platinum Anticancer Drugs by Human Copper ATPases ATP7A and ATP7B

et al. 2013

View full text Add to dashboard Cite

show abstract

“…8 mC-LΔ1-5 and mC-LΔ1-6 were constructed by PCR amplification of the first 63 amino acids of ATP7B (1-63) and inserting them into the Xho1 and BamH1 site of pLVX-mCherry upstream of ATP7B-Δ1-5 and ATP7B-Δ1-6 using infusion procedure. Forward and reverse primers used for PCR amplification of the first 63 amino acids were respectively, GGACTCAGATCTCGAGTTATGCCTGAGCAGGAGAGACAG and TAGATCCGGTGGATCCACA TGA CTG GCA AGT CAT GCC.…”

Section: Methodsmentioning

confidence: 99%

“…8 Conversion of the CXXC motif of each MDB to SXXS did not alter subcellular localization of ATP7B but did prevent it from mediating cDDP resistance. Deletion of either the first 5 or all 6 of the MBDs both prevented TGN localization and disabled its ability to mediate resistance.…”

Section: Introductionmentioning

confidence: 98%

“…5-7 The mechanism by which ATP7A and ATP7B regulate the sequestration and efflux of the Pt-containing drugs was proposed to be similar to that for Cu but recent data have demonstrated that substantial differences exists. 8 ATP7A and ATP7B reside in the trans -Golgi network (TGN). ATP7B was shown to co-localize with TGN markers TGN38, 9 p230 10 and syntaxin 6.…”

Section: Introductionmentioning

confidence: 99%

“…16-19 The CXXC motif in the MBDs of ATOX1 and ATP7B have been shown to interact with cDDP which can cause structural denaturation and multimerization of the MBDs at high concentrations. 8,20,21 …”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

The role of metal binding and phosphorylation domains in the regulation of cisplatin-induced trafficking of ATP7B

et al. 2013

Self Cite

View full text Add to dashboard Cite

The copper (Cu) exporter ATP7B mediates cellular resistance to cisplatin (cDDP) by increasing drug efflux. ATP7B binds and sequesters cDDP in into secretory vesicles. Upon cDDP exposure ATP7B traffics from the trans-Golgi network (TGN) to the periphery of the cell in a manner that requires the cysteine residues in its metal binding domains (MBD). To elucidate the role of the various domains of ATP7B in its cDDP-induced trafficking we expressed a series of mCherry-tagged variants of ATP7B in HEK293T cells and analyzed their subcellular localization in basal media and after a 1 h exposure to 30 μM cDDP. The wild type ATP7B and a variant in which the cysteines in the CXXC motifs of MBD 1-5 were converted to serines trafficked out of the trans-Golgi (TGN) when exposed to cDDP. Conversion of the cysteines in all 6 of the CXXC motifs to serines, or in only the sixth MBD, rendered ATP7B incapable of trafficking on exposure to cDDP. Truncation of MBD1-5 or MBD1-6 resulted in the loss of TGN localization. Addition of the first 63 amino acids of ATP7B to these variants restored TGN localization to a great extent and enabled the MBD1-5 variant to undergo cDDP-induced trafficking. A variant of ATP7B in which the aspartate 1027 residue in the phosphorylation domain was converted to glutamine localized to the TGN but was incapable of cDDP-induced trafficking. These results demonstrate that the CXXC motif in the sixth MBD and the catalytic activity of ATP7B are required for cDDP-induced trafficking as they are for Cu-induced redistribution of ATP7B; this provides further evidence that cDDP mimics Cu with respect to the molecular mechanisms by they control the subcellular distribution of ATP7B.

show abstract

Molecular Genetics of Wilson Disease

Roberts

2013

Encyclopedia of Life Sciences

View full text Add to dashboard Cite

Wilson disease is an autosomal‐recessive genetic disorder of hepatocellular copper disposition. It is rare but has a worldwide distribution. It is clinically diverse. Disease patterns include various kinds of liver disease; neurological movement disorders and psychiatric disease including psychosis, and less commonly recurrent haemolytic anaemia, osseomuscular abnormalities and cardiac dysrhythmias. The classic eye finding, the Kayser–Fleischer ring, has no functional impact. Thus far, only one gene has been identified whose mutations are causal for Wilson disease, ATP7B on chromosome 13q14.3, cloned in 1993. More than 500 mutations have been identified. The encoded protein is a metal‐transporting P‐type adenosine triphosphatase (ATPase), the Wilson ATPase, similar to copper transporters across the phyla. Simple genotypic explanation for the phenotypic diversity does not exist. The important genotype–phenotype correlation is that if the Wilson ATPase is absent or nonfunctional, severe disease (usually hepatic) commonly develops in the first decade of life. Clinically evident Wilson disease is fatal if not treated. The broad age range of diagnoses (3–80+ years) raises the question of incomplete penetrance, an issue along with gene modifiers currently under investigation. The possibility that mutations in other genes may result in Wilson disease has not been entirely eliminated. The contribution of ATP7B to non‐Wilsonian diseases is being determined. Key Concepts: Wilson disease is a rare (30 per million population, on average) autosomal‐recessive disorder of hepatic copper disposition. Wilson disease can present as almost any form of hepatic disease, or as neurological movement disorders, or as psychiatric disease. Genetic diagnosis is definitive; clinical application of genetic findings requires skilled interpretation; success rate for identifying one or both mutations can be highly variable. Most affected individuals are compound heterozygotes. Genetic testing is most efficient for investigating first‐degree relatives, who must be assessed for Wilson disease once a single family member has been diagnosed with Wilson disease. Wilson disease is an example of ‘endogenous hepatotoxicity’ where a normal component of the functioning organism is mishandled and becomes toxic. The mechanism of liver (and likely brain) damage involves oxidative stress with damage to mitochondria; apoptosis is typical. Concepts relating to drug‐induced hepatotoxicity are highly relevant to understanding the mechanism of damage and devising treatments. Metalloproteomics is a research strategy for examining copper disposition in normal and abnormal models/organisms. More than 500 mutations in ATP7B have been identified. These are mainly missense mutations, and less frequently small deletions or insertions, nonsense or splice‐site mutations. In contrast, the homologous gene ATP7A , abnormal in the X‐linked recessive disorder Menkes disease (with copper insufficiency), displays mainly large deletions. Predictably, the phenotypic variation depends on complex factors besides the genotype. The only important genotype–phenotype correlation is that severe disease (usually hepatic) typically develops very early in life if the Wilson ATPase is absent or nonfunctional. A convincing example of this correlation is provided by comparison of the Atp7b ‐knockout mouse and the toxic milk (tx‐j) mouse, which has a point mutation. Few modifying genes have been identified. Candidates include apolipoprotein E, human prion gene and BIRC4/XIAP. Females seem to have more severe Wilson disease. Other disorders of copper disposition exist. These include defects in ceruloplasmin production (aceruloplasminaemia and AT‐1 defect), various congenital glycosylation disorders, Indian childhood cirrhosis and its variants. In the Bedlington terrier, hepatic copper toxicosis is usually related to mutations in the gene for COMMD1. ATP7B may play a secondary role in some forms of Alzheimer disease. The Wilson ATPase plays a direct role in the hepatocellular handling of platinum compounds such as cisplatin.

show abstract

The CXXC motifs in the metal binding domains are required for ATP7B to mediate resistance to cisplatin

Cited by 47 publications

References 50 publications

Translocation of Platinum Anticancer Drugs by Human Copper ATPases ATP7A and ATP7B

Translocation of Platinum Anticancer Drugs by Human Copper ATPases ATP7A and ATP7B

The role of metal binding and phosphorylation domains in the regulation of cisplatin-induced trafficking of ATP7B

Molecular Genetics of Wilson Disease

Contact Info

Product

Resources

About