The Effect of Growth Hormone on Lipid Accumulation or Maturation in Adipocytes

Abstract

Background: Adipogenesis of adipocytes includes two stages: initiation and maturation. Growth hormone (GH) secretion is decreased in obese subjects and GH levels are inversely correlated with abdominal fat mass. The effects of growth hormone (GH) on lipids accumulation or maturation of adipocytes remains elusive. Methods: In the present study, effect of GH on lipid accumulation in vitro and in vivo was examined. cDNA microarray, quantitative real time-PCR (qPCR) and western blotting was used to analyze the expression of genes related to adipocyte lipid accumulation or degradation in pre- or mature 3T3-F442A adipocytes treated with GH and in epididymal adipose tissue of C57BL/6 mice administrated with GH. Level of adiponectin in supernatants of cultured F442A adipocytes was determined by enzyme-linked immune-sorbent assay. Results: We found that in 3T3-F442A especially 6 days post initiation of adipogenesis, GH intervention resulted in decreased expression of adipocyte maturation regulators (C/EBPα, PPARγ) and prominent genes related to lipid synthesis such as FAS and FABP, while the expression of UCP1 was markedly enhanced. cDNA microarray analysis and qPCR showed that the expression of SOCS2 and Adipor2 was increased under GH-treatment in mature 3T3-F442A adipocytes. GH treatment increased the mRNA expression of adiponectin and UCP1 in mature adipocytes. The above results were confirmed by in vivo study. Conclusions: GH potentially negatively modulates the maturation and accumulation of lipid in adipocytes.

Anthocyanins ameliorate palmitate‐induced inflammation and insulin resistance in 3T3‐L1 adipocytes

“…Total RNA was extracted using E.Z.N.A.® Total RNA kit according to manufacturer's instruction (OMEGA Bio‐Tek, VWR), quantified by Quanti‐iT TM RNA assay kit QUBIT (Invitrogen, Milan, Italy), and reverse transcripted with M‐MLV Reverse Transcriptase. Quantitative real‐time polymerase chain reaction (PCR; Applied Biosystems 7300 Real‐Time PCR System, CA, USA) coupled with SYBR green (SYBR green JumpStart Taq Ready Mix) was performed for identification of mRNA levels of IL6 (FW 5′‐GATGGATGCTACCAAACTGGAT‐3′, RV 5′‐CCAGGTAGCTATGGTACTCCAGA‐3′; Tsujimura et al, ), AdipoQ (FW 5′‐TGTTCCTCTTAATCCTGCCCA‐3′, RV 5′‐CCAACCTGCACAAGTTCCCTT‐3′), and FABP4 (FW 5′‐AAGGTGAAGAGCATCATAACCCT‐3′, RV 5′‐TCACGCCTTTCATAACACATTCC‐3′; Zhang et al, ). 18S rRNA (FW 5′‐GTAACCCGTTGAACCCCATT‐3′, RV 5′‐CCATCCAATCGGTAGTAGCG‐3′; Lood et al, ) was used as reference gene.…”

A cellular perspective of adipogenesis transcriptional regulation

“…GH influences adipocyte differentiation by both stimulatory and inhibitory effects. It is secreted from the anterior pituitary gland exerting critical metabolic effects through other substances that seem to mediate its action (Zhang et al, ); GH decreases fat mass, an effect probably mediated by its stimulation of lipolysis and inhibition of lipogenesis (Olarescu et al, ). However, the early studies by Howard Green group (Green, Morikawa, & Nixon, ; Morikawa et al, ) showed that GH has a direct action on 3T3‐F442A clone inducing their differentiation into fat cells.…”

Impact of 1,25(OH) 2 D 3 on TG content in liver of rats with type 2 diabetes

“…The expressions of these three genes in the liver of Group VitD+DM were significantly higher than Group T2DM, but the TG content is significantly reduced, so it also indirectly confirms that VitD can reduce the TG content in the liver tissue. When AdipoR2 is upregulated, it will activate the PPAR-α signaling pathway and act on the glucose and lipid metabolism-related enzymes, thereby enhancing the liver uptake of glucose 17 . Anderson also demonstrated that the activation of p38MAPK can prevent the accumulation of fat in the liver under high-fat feeding conditions 18 .…”