The effect of plant compartment and geographical location on shaping microbiome of Pulsatilla chinensis

Xing, Yanping; Bian, Che; Xue, He-fei; Song, Yueyue; Men, Wen-Xiao; Hou, Wenjuan; Yang, Yongqiang; Cai, Qian; Xu, Liang

doi:10.1007/s00253-023-12641-x

Cited by 3 publications

(3 citation statements)

References 60 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Furthermore, the Proteobacteria phylum exhibited pronounced predominance in both male and female plants, while the Acinetobacter genus was detected across all tissues of both types of plants. The prevalence of Proteobacteria has been documented in numerous plant species, including examples such as Pulsatilla chinensis (Xing et al 2023 ), Rehmannia glutinosa (Wu et al 2018 ), Cinnamomum camphora (Zhang et al 2020 ), Oryza sativa (Moronta-Barrios et al 2017 ), and Picrorhiza kurrooa (Tamang et al 2023 ), highlighting its widespread presence in various plants. The endophytic nature with plant growth-promoting properties of Acinetobacter has been well reported in many plants, including rice (Moronta-Barrios et al 2017 ), Papaver somniferum (Pandey et al 2016a ), and sugar beet (Shi et al 2011 ).…”

Section: Discussionmentioning

confidence: 99%

Unraveling endophytic diversity in dioecious Siraitia grosvenorii: implications for mogroside production

Tamang,

Kaur,

Thakur

et al. 2024

Appl Microbiol Biotechnol

View full text Add to dashboard Cite

Host and tissue-specificity of endophytes are important attributes that limit the endophyte application on multiple crops. Therefore, understanding the endophytic composition of the targeted crop is essential, especially for the dioecious plants where the male and female plants are different. Here, efforts were made to understand the endophytic bacterial composition of the dioecious Siraitia grosvenorii plant using 16S rRNA amplicon sequencing. The present study revealed the association of distinct endophytic bacterial communities with different parts of male and female plants. Roots of male and female plants had a higher bacterial diversity than other parts of plants, and the roots of male plants had more bacterial diversity than the roots of female plants. Endophytes belonging to the phylum Proteobacteria were abundant in all parts of male and female plants except male stems and fruit pulp, where the Firmicutes were most abundant. Class Gammaproteobacteria predominated in both male and female plants, with the genus Acinetobacter as the most dominant and part of the core microbiome of the plant (present in all parts of both, male and female plants). The presence of distinct taxa specific to male and female plants was also identified. Macrococcus, Facklamia, and Propionibacterium were the distinct genera found only in fruit pulp, the edible part of S. grosvenorii. Predictive functional analysis revealed the abundance of enzymes of secondary metabolite (especially mogroside) biosynthesis in the associated endophytic community with predominance in roots. The present study revealed bacterial endophytic communities of male and female S. grosvenorii plants that can be further explored for monk fruit cultivation, mogroside production, and early-stage identification of male and female plants. Key points • Male and female Siraitia grosvenorii plants had distinct endophytic communities • The diversity of endophytic communities was specific to different parts of plants • S. grosvenorii-associated endophytes may be valuable for mogroside biosynthesis and monk fruit cultivation

show abstract

Section: Discussionmentioning

confidence: 99%

Unraveling endophytic diversity in dioecious Siraitia grosvenorii: implications for mogroside production

Tamang,

Kaur,

Thakur

et al. 2024

Appl Microbiol Biotechnol

View full text Add to dashboard Cite

show abstract

“…Furthermore, although Cladosporium species are marker populations in fruit samples from the medicinal parts of S. chinensis , they frequently occur as secondary invaders of saprophytic or follicular lesions with other phytopathogenic fungi ( Sandoval-Denis et al, 2015 ). These differences in marker species are closely associated with the different functions of the various compartments, thus suggesting that the compartments play a role in microbial selection ( Xing et al, 2023 ). S. chinensis samples from different geographical locations, however, showed similarities in the core microbial communities of the same tissue.…”

Section: Discussionmentioning

confidence: 99%

“…The extracted DNA was subjected to 0.8% agarose gel electrophoresis for molecular size determination and quantified with a Nanodrop NC2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, United States). Based on the sequenced regions (V5–V7 for symbiotic bacteria; ITS1 for symbiotic fungi), specific primers with barcode were used (16S rRNA V5–V7: F: AACMGGATTAGATACCCKG, R: ACGTCATCCCCACCTTCC; ITS1(b): F: CTTGGTCATTTAGAGGAAGTAA, R: GCTGCGTTCTTCATCGATGC) for amplification and sequencing ( Horton et al, 2014 ; Xing et al, 2023 ). The PCR reaction mixture included the following components: 0.25 μL of Q5 high-fidelity DNA polymerase, 5 μL of 5× reaction buffer, 5 μL of 5× high GC buffer, 2 μL of dNTP (10 mM), 2 μL of template DNA, 1 μL each of forward and reverse primers (10 μM), and 8.75 μL of ddH 2 O.…”

Section: Methodsmentioning

confidence: 99%

Exploring the diversity and potential functional characteristics of microbiota associated with different compartments of Schisandra chinensis

Hou,

Xing,

Xue

et al. 2024

Front. Microbiol.

Self Cite

View full text Add to dashboard Cite

IntroductionSymbiotic microbial have a significant impact on the growth and metabolism of medicinal plants. Schisandra chinensis is a very functionally rich medicinal herb; however, its microbial composition and diversity have been poorly studied.MethodsIn the present study, the core microbiomes associated with the rhizospheric soil, roots, stems, leaves, and fruits of S. chinensis from six geographic locations were analyzed by a macro-genomics approach.ResultsAlpha and beta diversity analyses showed that the diversity of microbial composition of S. chinensis fruits did not differ significantly among the geographic locations as compared to that in different plant compartments. Principal coordinate analysis showed that the microbial communities of S. chinensis fruits from the different ecological locations were both similar and independent. In all S. chinensis samples, Proteobacteria was the most dominant bacterial phylum, and Ascomycota and Basidiomycota were the most dominant fungal phyla. Nitrospira, Bradyrhizobium, Sphingomonas, and Pseudomonas were the marker bacterial populations in rhizospheric soils, roots, stems and leaves, and fruits, respectively, and Penicillium, Golubevia, and Cladosporium were the marker fungal populations in the rhizospheric soil and roots, stems and leaves, and fruits, respectively. Functional analyses showed a high abundance of the microbiota mainly in biosynthesis.DiscussionThe present study determined the fungal structure of the symbiotic microbiome of S. chinensis, which is crucial for improving the yield and quality of S. chinensis.

show abstract

Harnessing the plant microbiome for environmental sustainability: From ecological foundations to novel applications

Hao,

Li,

2024

Science of The Total Environment

View full text Add to dashboard Cite

The effect of plant compartment and geographical location on shaping microbiome of Pulsatilla chinensis

Cited by 3 publications

References 60 publications

Unraveling endophytic diversity in dioecious Siraitia grosvenorii: implications for mogroside production

Unraveling endophytic diversity in dioecious Siraitia grosvenorii: implications for mogroside production

Exploring the diversity and potential functional characteristics of microbiota associated with different compartments of Schisandra chinensis

Harnessing the plant microbiome for environmental sustainability: From ecological foundations to novel applications

Contact Info

Product

Resources

About