The Effect of Urea, Formamide, and Glycols on the Secondary Binding Forces in the Ion-Exchange Chromatography of Polynucleotides on DEAE-Cellulose<sup>*</sup>

Tomlinson, R. V.; Tener, G. M.

doi:10.1021/bi00904a013

Cited by 325 publications

(62 citation statements)

References 19 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The separation of the 5'-terminal oligonucleotide (peak II) from the isopleths (peak-I) in Fig. 2 was successful because ion exchange chromatography in 7 M urea separates predominantly according to charge (17) (Fig. 2), whereas the second dimension of the slab gel electrophoresis separates according to size and charge (13).…”

Section: Methodsmentioning

confidence: 99%

The 5'-terminal structures of poliovirion RNA and poliovirus mRNA differ only in the genome-linked protein VPg.

Nomoto¹,

Kitamura²,

Golini³

et al. 1977

Proc. Natl. Acad. Sci. U.S.A.

164

101

View full text Add to dashboard Cite

The 5'-terminal, RNase Ti-resistant oligonucleotide of poliovirus mRNA has been isolated. Its sequence is pU-U-A-A-A-A-C-A-Gp, which is identical to that of virion The genome of poliovirus, a plus-strand RNA virus (1), is covalently linked to a small basic protein, which we have called VPg (2-4). VPg is attached to the 5'-terminal uridine of the single-stranded RNA via an unknown linkage group (5).After penetration into the host cell, the RNA of the infecting poliovirion is thought to serve a dual function: first as mRNA in virus-specific protein synthesis and second as template in RNA replication (6). Poliovirus mRNA, that is, viral RNA isolated from polyribosomes of infected cells, has previously been considered to be identical to virion RNA because mRNA and virion RNA have the same sedimentation coefficient of 35 S, have the same base composition (7,8), and yield indistinguishable fingerprints (9). In contrast to virion RNA, however, the 5' end of poliovirus mRNA is not linked to a protein. Poliovirus mRNA begins with pUp (9-11) and is the only mammalian mRNA known to date that is "uncapped" (12).Available evidence suggests that nascent strands of the replicative intermediate, minus strands of replicative intermediate and of double-stranded RNA, and progeny virion RNA are VPg-linked (5). Thus, all species of newly synthesized viral RNAs appear to be attached to a protein with the notable exception of mRNA. This observation has led us to propose that the protein or an (oligo)nucleotidyl-protein is cleaved from plus-strand RNA prior to polyribosome formation (3, 5). In order to identify the mode of cleavage we have isolated and sequenced the 5'-terminal, RNase Ti-resistant oligonucleotide of polio mRNA and compared it to the corresponding oligonucleotide of virion RNA (4, 5). Here we report that the 5'-terminal nucleotide sequence of poliovirus mRNA is pU-U-A-A-A-A-C-A-Gp and is identical to the 5'-terminal VPgpU-U-A-A-A-A-C-A-Gp of virion RNA (4, 5). This result indicates that the site of cleavage is the linkage between protein and RNA and not an internucleotide bond.We also report that proteolytic removal of VPg does not alter the specific infectivity of virion RNA, an observation suggesting that VPg is not involved in an early step of viral replication.The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U. S. C. §1734 solely to indicate this fact. MATERIALS AND METHODS32P-Labeled poliovirus type 1 (Mahoney) was grown in spinner cultures of S3 HeLa cells, and poliovirus [32P]mRNA was isolated from polyribosomes as previously described (9, 13). Enzymatic digestions and separation of products by one-or twodimensional gel electrophoresis, paper electrophoresis, or column chromatography were performed as published (3,5,9,13 300 ,ug/ml/10% (vol/vol) dimethyl sulfoxide. After rapid shaking of the suspension for 10 min at 370, more HeLa cells and a solution of 1.4% agar were adde...

show abstract

Section: Methodsmentioning

confidence: 99%

The 5'-terminal structures of poliovirion RNA and poliovirus mRNA differ only in the genome-linked protein VPg.

Nomoto¹,

Kitamura²,

Golini³

et al. 1977

Proc. Natl. Acad. Sci. U.S.A.

164

101

View full text Add to dashboard Cite

show abstract

“…Purified reverse transcriptase from avian myeloblastosis virus was obtained from Joseph Beard through the Virus Cancer Program. Oligothymidylic acid primer molecules were synthesized chemically by standard procedures (8) and purified according to chain-length by column chromatography on DEAE-cellulose in the presence of 7 M urea (9 In addition, the data suggest that the order of appearance of nucleotides in the DNA product is dG, then dA, and finally dC. It is not possible, however, to determine the order of incorporation of the first dT residue into DNA from these experiments.…”

mentioning

confidence: 99%

Rous sarcoma virus genome is terminally redundant: the 3' sequence.

Schwartz¹,

Zamecnik²,

Weith³

1977

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

A sequence of 20 nucleotide residues immediately adjacent to the 3'-terminal poly(A) in Rous sarcoma virus (Prague strain, subgroup C) 35S RNA has been determined by extension of a riboguanylic acid-terminated oligothymidylic acid primer hybridized at the 5' end of the 3'-terminal poly (A) with purified reverse transcriptase (RNA-directed DNA polymerase; deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase, EC 2.7.7.7) from avian myeloblastosis virus. The sequence is 5'GCCAUUUUACCAUUCACCACpoly(A)3'. This same nucleotide sequence, excluding the poly(A) segment, has also been found at the 5' terminus of Rous sarcoma virus RNA (W. A. Haseltine, A. Maxam, and W. Gilbert, this issue,, and therefore the RNA genome of this virus is terminally redundant. Possible mechanisms for endogenous in vitro copying of the complete RNA genome by reverse transcriptase which involve terminally repeated nucleotide sequences are discussed.Determination of the primary structure of the region immediately adjacent to the 3'-terminal poly(A) sequence of RNA tumor virus genomes is of considerable importance. Various models for synthesis of virus particles in infected cells suggest that the viral RNA genome is transcribed from proviral genes integrated in the host DNA (1). Thus, tumor virus RNA genomes and eukaryotic mRNA molecules may have common structural features adjacent to the 3-terminal poly(A) sequence that represent signals for termination of transcription and possibly recognition sites for post-transcriptional addition of the poly(A) sequence. More In addition, the data suggest that the order of appearance of nucleotides in the DNA product is dG, then dA, and finally dC. It is not possible, however, to determine the order of incorporation of the first dT residue into DNA from these experiments.

show abstract

“…The new phosphodiesters would then carry one net negative charge, but when these were chromatographed on a column of Sephadex A-25 only minimal retention of these species was observed (see Bannon & Verly, 1972). DEAE-cellulose, however, would be expected to retain species carrying a single net negative charge (Tomlinson & Tener, 1963), and this was confirmed by using the dinucleosides C-C, C-A and C-G. The most weakly retained of these, C-C, remained bound to the column during the elution of deoxy- guanosine, which is the most strongly retained of the four deoxynucleosides; the RF values of these dinucleosides relative to C-C were 1.11 and 1.22 respectively.…”

Section: Resultsmentioning

confidence: 99%

Phosphotriesters in rat liver deoxyribonucleic acid after the administration of the carcinogen NN-dimethylnitrosamine in vivo

O’Connor

Marigison

Craig

1975

Biochemical Journal

View full text Add to dashboard Cite

After treatment with methylnitrosamine, samples of DNA were isolated from rat livers by a conventional phenol procedure and examined for the presence ofphosphotriesters. A method capable of detecting relatively small amounts of '4C-labelled phosphotriesters was developed and used to establish that these products account for 10-12% of the total methylation pattern found after treatment with this agent in vivo. The significance of the presence of phosphotriesters in DNA is discussed.

show abstract

The Effect of Urea, Formamide, and Glycols on the Secondary Binding Forces in the Ion-Exchange Chromatography of Polynucleotides on DEAE-Cellulose^*

Cited by 325 publications

References 19 publications

The 5'-terminal structures of poliovirion RNA and poliovirus mRNA differ only in the genome-linked protein VPg.

The 5'-terminal structures of poliovirion RNA and poliovirus mRNA differ only in the genome-linked protein VPg.

Rous sarcoma virus genome is terminally redundant: the 3' sequence.

Phosphotriesters in rat liver deoxyribonucleic acid after the administration of the carcinogen NN-dimethylnitrosamine in vivo

Contact Info

Product

Resources

About

The Effect of Urea, Formamide, and Glycols on the Secondary Binding Forces in the Ion-Exchange Chromatography of Polynucleotides on DEAE-Cellulose*

Cited by 325 publications

References 19 publications

The 5'-terminal structures of poliovirion RNA and poliovirus mRNA differ only in the genome-linked protein VPg.

The 5'-terminal structures of poliovirion RNA and poliovirus mRNA differ only in the genome-linked protein VPg.

Rous sarcoma virus genome is terminally redundant: the 3' sequence.

Phosphotriesters in rat liver deoxyribonucleic acid after the administration of the carcinogen NN-dimethylnitrosamine in vivo

Contact Info

Product

Resources

About

The Effect of Urea, Formamide, and Glycols on the Secondary Binding Forces in the Ion-Exchange Chromatography of Polynucleotides on DEAE-Cellulose^*