The Endoplasmic Reticulum Cargo Receptor SURF4 Facilitates Efficient Erythropoietin Secretion

Abstract

Erythropoietin (EPO) stimulates erythroid differentiation and maturation. Though the transcriptional regulation of EPO has been well studied, the molecular determinants of EPO secretion remain unknown. Here, we generated a HEK293T reporter cell line that provides a quantifiable and selectable readout of intracellular EPO levels and performed a genome-scale CRISPR screen that identified SURF4 as an important mediator of EPO secretion. Targeting SURF4 with multiple independent sgRNAs resulted in intracellular accumulation and extracellular depletion of EPO. Both of these phenotypes were rescued by expression of SURF4 cDNA. Additionally, we found that disruption of SURF4 resulted in accumulation of EPO in the ER compartment, and that SURF4 and EPO physically interact. Furthermore, SURF4 disruption in Hep3B cells also caused a defect in the secretion of endogenous EPO under conditions mimicking hypoxia, ruling out an artifact of heterologous overexpression. This work demonstrates that SURF4 functions as an ER cargo receptor that mediates the efficient secretion of EPO. Our findings also suggest that modulating SURF4 may be an effective treatment for disorders of erythropoiesis that are driven by aberrant EPO levels. Finally, we show that SURF4 overexpression results in increased secretion of EPO, suggesting a new strategy for more efficient production of recombinant EPO.

SEC23A rescues SEC23B-deficient congenital dyserythropoietic anemia type II

“…HUDEP-2 cells were coelectroporated (Lonza 4D nucleofector) with a PX459 plasmid expressing an sgRNA (ATTAGCACTTCAAGCAGCAC) targeting the SEC23A locus immediately upstream of the stop codon and with a donor template allowing insertion of the GFP coding sequence by homology-directed repair. The donor template was assembled as previously described ( 81 ) in a pUC19 vector (pUC19 was a gift from J. Messing, Addgene plasmid #50005) ( 82 ) using the NEBuilder HiFi DNA assembly cloning kit [New England Biolabs (NEB)] with the following consecutive sequences: an ~800-base pair (bp) homology arm upstream of the sgRNA cut site, a sequence encoding a linker protein (GGAPAPAPAPAPAPAPAPG), the GFP-coding sequence followed by a stop codon, and an ~800-bp homology arm downstream of the sgRNA cut site (fig. S5A).…”

Surf4 facilitates reprogramming by activating the cellular response to endoplasmic reticulum stress

“… 14 SURF4 circulates between the ER/ER‐Golgi intermediate compartment (ERGIC)/Golgi and mediates the anterograde or retrograde transport of cargo proteins. 13 , 15 , 16 , 17 , 18 , 19 Disruption of Surf4 trafficking results in a reduction in the number of ERGIC clusters 20 and accumulation of cargo proteins in the ER compartment. 21 Dysregulation of ER‐Golgi vesicle transport induces ER stress, 22 and in turn, when ER stress occurs, the expression of Erv29p significantly increases.…”

Surf4 Promotes Endoplasmic Reticulum Exit of the Lysosomal Prosaposin-Progranulin Complex

“…Collectively, these quantitative analyses of the dynamic trafficking of prosaposin and progranulin establish a critical role for Surf4 in their delivery from the ER to the Golgi. Notably, ~6.6 fold reduction in the ER to Golgi traffic of prosaposin-RUSH in Surf4 KO cells stands out compared to what has been reported for other Surf4-dependent cargos and CLN6/CLN8 dependent lysosomal hydrolase cargos 23,[25][26][27] . This demonstrates the major extent to which Surf4 prioritizes the ER export of prosaposin (and by extension progranulin).…”