The essential role of nitrogen limitation in expression of xplA and degradation of hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) in Gordonia sp. strain KTR9

Abstract

Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) is a widely used explosive and a major soil and groundwater contaminant. Organisms such as Gordonia sp. KTR9, capable of degrading RDX and using it as an N source, may prove useful for bioremediation of contaminated sites. XplA is a cytochrome P450 monooxygenase responsible for RDX degradation. Expression of xplA in KTR9 was not induced by RDX but was strongly induced (50-fold) during N-limited growth. When glnR, encoding a regulatory protein affecting N assimilation in diverse Actinobacteria, was deleted from KTR9, the bacterium lost the ability to use nitrate, nitrite, and RDX as N sources. Deletion of glnR also abolished the inhibition of xplA expression by nitrite. Our results confirm the essential role of GlnR in regulating assimilation of nitrite, but there was no evidence for a direct role of GlnR in regulating XplA expression. Rather, the general availability of nitrogen repressed XplA expression. We conclude that the inability of the glnR mutant to use RDX as an N source was due to its inability to assimilate nitrite, an intermediate in the assimilation of nitrogen from RDX. Regulation of XplA does not seem adaptive for KTR9, but it is important for RDX bioremediation with KTR9 or similar bacteria.

Effect of Sodium Alginate on the Morphology and Properties of High Energy Insensitive Explosive TKX‐50

“…Continuous developments of weapon systems have imposed urgent demands of novel energetic materials with high energy densities and low vulnerability. The energy density of traditional energetic materials is usually improved by increasing nitro content, which not only complicates the synthesis route, but also increases the mechanical sensitivity and toxicity of the materials [1][2][3][4][5][6][7]. Therefore, in recent years, the development of novel high-energy and environment friendly green energetic materials has become a main research direction [8].…”

Effects of Perchlorate and Other Groundwater Inorganic Co-Contaminants on Aerobic RDX Degradation

“…In other studies, expression of xplA in Gordonia sp. strain KTR9 was strongly induced by nitrogen limitation [ 18 ]. In experiments where ammonium (0.9 mM) in the culture medium was consumed, xplA expression increased up to 150-fold.…”

“…Although deletion of glnR (encoding a regulatory protein affecting nitrogen assimilation in diverse Actinobacteria ) also abolished the inhibition of xplA expression by nitrite, there was no evidence for a direct role of glnR in regulating xplA expression. Instead, the general availability of nitrogen repressed xplA expression [ 18 ]. Similarly, in Rhodococcus rhodochrous 11Y, xplA expression was induced under nitrogen-limiting conditions and further enhanced by the presence of RDX [ 19 ].…”

Expression and characterization of an <i>N</i>-oxygenase from <i>Rhodococcus jostii</i> RHAI

“…qPCR Reactions were performed using an Applied Biosystems 7900HT system. PCR was carried out in 20 µl reaction volumes containing 0.25 µmol primers (primers RHAI_ro06104f, TGACGGT-GGCGGAGATCT and RHAI_ro06104r, CGGCTGG-ATGACGTCGTT for RHAI-ro06104 and primers RHAIsigA_F, GGCGTGATGTCCATTTCCTT and RHAIsigA_R, CATGGTGGAGGTCATCAACAAG for sigA from RHAI (Zhu et al, 2015)) and 60 ng of cDNA template using the Invitrogen 2X Power SYBR master mix. Amplification conditions for this reaction consisted of a single step at 95°C for 10 min followed by 40 cycles at 95°C for 15 s and 60°C for 1 min.…”

“…Amplification conditions for this reaction consisted of a single step at 95°C for 10 min followed by 40 cycles at 95°C for 15 s and 60°C for 1 min. Data were analyzed using the accompanying Applied Biosystems 7900HT analysis software to generate relative gene expression values across the growth conditions tested based on "delta delta Ct" values (Livak and Schmittgen, 2001) using the sigA from R. jostii RHAI as an endogenous control (Zhu et al, 2015). N-oxygenase protein purification and activity assay.…”