The Fas and Fas ligand pathways in liver allograft tolerance

Abstract

The Fas and Fas ligand (Fas/FasL) pathways may play a central role in cytotoxicity or immunoregulation in liver transplantation. Here, in an attempt to examine the role of Fas/FasL on drug-free tolerance, we measured mRNA levels of Fas/FasL in livers by reverse transcriptase-polymerase chain reaction (RT-PCR), and also protein levels of Fas/FasL in livers by immunohistochemistry and in serum by dot blot assay. PVG recipients bearing DA livers showed serious rejection between post-operative (POD) days 7 and 14, but this rejection was naturally overcome without any immunosuppression. Fas gene and protein products were expressed on almost every cell in livers taken from naive rats, and at any time point in both syngeneic and allogeneic orthotopic liver transplantation (OLT) rats. In contrast, FasL mRNA in DA livers was detectable at POD 2, peaked at POD 14, and declined at POD 63 in allogeneic OLT (DA-PVG). Although the FasL gene was detectable in isografts at POD 14, its expression was much lower than in allografts. The time course and localization of FasL expression indicated that the expression of FasL gradually switched from infiltrating cells to hepatocytes when the rejection was naturally overcome and tolerance was induced in this OLT model. Soluble Fas could constitutively be detected at any time point in the serum of the tolerogenic OLT (DA-PVG) rats and was not diminished during the rejection phase. Soluble FasL peaked at POD 14 in allogeneic OLT, while sFasL was significantly lower in the serum of normal and syngeneic OLT rats. These findings suggest that the Fas and FasL pathways, including soluble forms, may contribute to the control of the immune response in this drug-free tolerance OLT model.

FasL Expression in Hepatic Antigen-Presenting Cells and Phagocytosis of Apoptotic T Cells by FasL+ Kupffer Cells Are Indicators of Rejection Activity in Human Liver Allografts

“…Although experimental studies have asserted that manipulation of the Fas/FasL system might provide apoptosis signals to induce allospecific immunosuppression, 22,23 the interaction between donor and recipient cells on APCs and Fas/FasL expression is poorly understood in human liver allografts. Our study has demonstrated that FasL is abundantly expressed on KCs, endothelial cells in human liver allografts undergoing ACR and, to a lesser extent, allografts undergoing CR.…”

“…24,25 Phagocytosis itself triggers macrophage release of FasL and induces apoptosis of bystander leukocytes. 23 The apoptotic recipient T cells in the study could be graft-specific cells. The findings of clonal T-cell proliferation were presumptive evidence of cellular responses to alloantigens.…”

Expression, by functional proteomics, of spontaneous tolerance in rat orthotopic liver transplantation

“…Total RNA was subjected to reverse transcription polymerase reaction for interleukin‐2 (IL‐2) with the forward and reverse cytokine primers employed as previously described 17 . In addition, a partial Hp cDNA was also prepared by RT–PCR 18 . The following Hp‐specific primers 19 were used for PCR: 5′‐GTGGAATTGGGCAATGATGCCACA‐3′ (sense) and 5′‐GTCACTGATCACTGTGGCC CCAGT‐3′ (antisense).…”

Hepatic stellate cells promote immunotolerance following orthotopic liver transplantation in rats via induction of T cell apoptosis and regulation of Th2/Th3-like cell cytokine production

“…Specifically, FasL expressed by infiltrating cells induces liver cell apoptosis during acute rejection following liver transplantation. However, the increased expression of FasL in liver allografts results in immunotolerance by combining with Fas expressed by the infiltrating lymphocytes (26,27). This phenomenon may be explained by the expression of FasL gradually switching from infiltrating cells to hepatocytes.…”