The fatty acid elongase NOA is necessary for viability and has a somatic role in<i>Drosophila</i>sperm development

Jung, Anita; Hollmann, Martin; Schäfer, Mireille

doi:10.1242/jcs.006551

Cited by 52 publications

(44 citation statements)

References 44 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Loss of the genomic region was verified by PCR. As this recombination also removes part of the 39 untranslated region of baldspot, we introduced a rescue construct (Jung et al, 2007), which partially reversed the embryonic lethality.…”

Section: Fly Stocks and Geneticsmentioning

confidence: 99%

Gα73Β is a downstream effector of JAK/STAT signalling and a regulator of Rho1 inDrosophilahaematopoiesis

Bausek

Zeidler

2013

Journal of Cell Science

View full text Add to dashboard Cite

JAK/STAT signalling regulates many essential developmental processes including cell proliferation and haematopoiesis, whereas its inappropriate activation is associated with the majority of myeloproliferative neoplasias and numerous cancers. Furthermore, high levels of JAK/STAT pathway signalling have also been associated with enhanced metastatic invasion by cancerous cells. Strikingly, gain-of-function mutations in the single Drosophila JAK homologue, Hopscotch, result in haemocyte neoplasia, inappropriate differentiation and the formation of melanised haemocyte-derived 'tumour' masses; phenotypes that are partly orthologous to human gain-of-function JAK2-associated pathologies. Here we show that Ga73B, a novel JAK/STAT pathway target gene, is necessary for JAK/STAT-mediated tumour formation in flies. In addition, although Ga73B does not affect haemocyte differentiation, it does regulate haemocyte morphology and motility under non-pathological conditions. We show that Ga73B is required for constitutive, but not injury-induced, activation of Rho1 and for the localisation of Rho1 into filopodia upon haemocyte activation. Consistent with these results, we also show that Rho1 interacts genetically with JAK/STAT signalling, and that wild-type levels of Rho1 are necessary for tumour formation. Our findings link JAK/STAT transcriptional outputs, Ga73B activity and Rho1-dependent cytoskeletal rearrangements and cell motility, therefore connecting a pathway associated with cancer with a marker indicative of invasiveness. As such, we suggest a mechanism by which JAK/STAT pathway signalling may promote metastasis.

show abstract

Section: Fly Stocks and Geneticsmentioning

confidence: 99%

Gα73Β is a downstream effector of JAK/STAT signalling and a regulator of Rho1 inDrosophilahaematopoiesis

Bausek

Zeidler

2013

Journal of Cell Science

View full text Add to dashboard Cite

show abstract

“…UAS-lifeact-GFP was used to label filamentous actin. For the UAS-lifeact-GFP construct, the codons (atgggcgtggccgatctgatcaagaagttcgagagcatcagcaaggaggaa) of the lifeact peptide [MGVADLIKKFESISKEE; (Riedl et al, 2008)] were cloned in frame into the pUASt-green vector, containing an eGFP cassette (Brand and Perrimon, 1993;Jung et al, 2007) by using synthetic oligonucleotides (CTCTAGatgggcgtggccgatctgatcaagaagttcgagagcatcagcaaggaggaA; CCGGTtcctccttgctgatgctctcgaacttcttgatcagatcggccacgcccatCTAGAGGTAC) and restriction sites for KpnI and AgeI. Transgenic flies were established as reported previously (Berger et al, 2008).…”

Section: Fly Stocksmentioning

confidence: 99%

Transcriptional regulation of Profilin during wound closure in Drosophila larvae

Brock

Wang

Berger

et al. 2012

Journal of Cell Science

View full text Add to dashboard Cite

SummaryInjury is an inevitable part of life, making wound healing essential for survival. In postembryonic skin, wound closure requires that epidermal cells recognize the presence of a gap and change their behavior to migrate across it. In Drosophila larvae, wound closure requires two signaling pathways [the Jun N-terminal kinase (JNK) pathway and the Pvr receptor tyrosine kinase signaling pathway] and regulation of the actin cytoskeleton. In this and other systems, it remains unclear how the signaling pathways that initiate wound closure connect to the actin regulators that help execute wound-induced cell migrations. Here, we show that chickadee, which encodes the Drosophila Profilin, a protein important for actin filament recycling and cell migration during development, is required for the physiological process of larval epidermal wound closure. After injury, chickadee is transcriptionally upregulated in cells proximal to the wound. We found that JNK, but not Pvr, mediates the increase in chic transcription through the Jun and Fos transcription factors. Finally, we show that chic-deficient larvae fail to form a robust actin cable along the wound edge and also fail to form normal filopodial and lamellipodial extensions into the wound gap. Our results thus connect a factor that regulates actin monomer recycling to the JNK signaling pathway during wound closure. They also reveal a physiological function for an important developmental regulator of actin and begin to tease out the logic of how the wound repair response is organized.

show abstract

“…During spermatid differentiation, an actin-rich individualization complex made up of 64 actin cones forms and transverses the sperm cyst cells, stripping the spermatids of their excess mass. Knockdown of noa expression specifically in the somatic sperm cyst cells causes the individualization complex to dissociate and the individualization cones to appear morphologically abnormal (Jung et al 2007). Thus, Elovl6 modulation of the fatty acid composition is broadly necessary for viability but also has a specific role in maintaining the structural cytoskeletal components necessary for sperm differentiation.…”

Section: Lipid Synthesis In Gametogenesis and Fertilization In Drosopmentioning

confidence: 99%

Emerging roles for specific fatty acids in developmental processes

Vrablik¹,

Watts²

2012

Genes Dev.

View full text Add to dashboard Cite

Animals synthesize a vast range of fatty acids serving diverse cellular functions. The roles of specific fatty acids in early development are just beginning to be characterized. In the March 15, 2012, issue of Genes & Development, Kniazeva and colleagues (pp. 554–566) describe how the particular combination of a branched chain fatty acid and an acyl-CoA synthetase is required for critical cellular processes during early embryogenesis in Caenorhabditis elegans.

show abstract

The fatty acid elongase NOA is necessary for viability and has a somatic role inDrosophilasperm development

Cited by 52 publications

References 44 publications

Gα73Β is a downstream effector of JAK/STAT signalling and a regulator of Rho1 inDrosophilahaematopoiesis

Gα73Β is a downstream effector of JAK/STAT signalling and a regulator of Rho1 inDrosophilahaematopoiesis

Transcriptional regulation of Profilin during wound closure in Drosophila larvae

Emerging roles for specific fatty acids in developmental processes

Contact Info

Product

Resources

About