The first instance of HPR-deleted ISAV detection in eviscerated, fresh salmon at a Chinese entry-exit port

Lu, Xiao; Lin, Hua; Yang, Miao; Chen, Shijie; An, Wei; Wu, Xulong; Liu, Hong; Li, Dandan; Yue, Yan; Hu, Juan; Wang, Jun; YingJie, Sun

doi:10.1016/j.aquaculture.2017.12.001

Cited by 5 publications

(3 citation statements)

References 21 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The mortality incident was reported to be caused by sea lice treatment. No suspicion of ISA was reported; however, ISAV was detected in exported salmon fillets, originating from this farm, at entry inspection to China (Xiao et al, 2018). This finding was later confirmed by RT-qPCR testing of stored frozen filets by the Norwegian Veterinary Institute.…”

mentioning

confidence: 67%

Infectious salmon anaemia virus detected by RT‐qPCR in Norwegian farmed rainbow trout, Oncorhynchus mykiss (Walbaum, 1792)

Alarcón

Moldal

Jansen

et al. 2020

Journal of Fish Diseases

View full text Add to dashboard Cite

show abstract

mentioning

confidence: 67%

Infectious salmon anaemia virus detected by RT‐qPCR in Norwegian farmed rainbow trout, Oncorhynchus mykiss (Walbaum, 1792)

Alarcón

Moldal

Jansen

et al. 2020

Journal of Fish Diseases

View full text Add to dashboard Cite

show abstract

“…The focus is on information (geographical occurrence, variants, transmission and reservoirs) that can be obtained from phylogenetic analysis of segment six from high (HPRΔ) and low (HPR0) virulent ISA viruses from fresh and sea water in Norway, Scotland, Faeroe Islands and Chile. This segment has been used in several earlier studies of the relationship between existing ISA viruses and for inferring short and long distance transmission [33, 34, 37, 41, 43, 46, 48, 49, 51, 52, 53, 55, 58, 70, 71, 72]. Admittedly, the change from low to high virulent variants of ISA viruses is, based on existing knowledge, dependent on mutational changes in both segment five (fusion protein, F, gene) and segment six (hemagglutinin-esterase, HE, gene) [49, 50, 53, 56, 57, 58], but all HPRΔ variants have so far been of higher virulence than HPR0 variants.…”

Section: Discussionmentioning

confidence: 99%

Wild and farmed salmon (Salmo salar) as reservoirs for infectious salmon anaemia virus, and the importance of horizontal- and vertical transmission

et al. 2019

View full text Add to dashboard Cite

The infectious salmon anaemia virus (ISAV) is an important pathogen on farmed salmon in Europe. The virus occurs as low- and high virulent variants where the former seem to be a continuous source of new high virulent ISAV. The latter are controlled in Norway by stamping out infected populations while the former are spreading uncontrolled among farmed salmon. Evidence of vertical transmission has been presented, but there is still an ongoing discussion of the importance of circulation of ISAV via salmon brood fish. The only known wild reservoirs are in trout ( Salmo trutta ) and salmon ( Salmo salar ). This study provides the first ISAV sequences from wild salmonids in Norway and evaluates the importance of this reservoir with respect to outbreaks of ISA among farmed salmon. Phylogenetic analyses of the surface protein hemagglutinin-esterase gene from nearly all available ISAV from Norway, Faeroe Islands, Scotland, Chile and wild salmonids in Norway show that they group into four major clades. Including virulent variants in the analysis show that they belong in the same four clades supporting the hypothesis that there is a high frequency of transition from low to high virulent variants in farmed populations of salmon. There is little support for a hypothesis suggesting that the wild salmonids feed the virus into farmed populations. This study give support to earlier studies that have documented local horizontal transmission of high virulent ISAV, but the importance of transition from low- to high virulent variants has been underestimated. Evidence of vertical transmission and long distance spreading of ISAV via movement of embryos and smolt is presented. We recommend that the industry focus on removing the low virulent ISAV from the brood fish and that ISAV-free brood fish salmon are kept in closed containment systems (CCS).

show abstract

“…® Total RNA Kit (Omega Bio‐tek) according to the manufacturer's instructions. First‐strand cDNA from the HPR and segment 5 putative cleavage site regions was synthesized using Moloney murine leukaemia virus reverse transcriptase (Promega) with the specific primers S5_Fw (TACAACGGAAAGGATTAAGACTG), S5_Rv (TCTCCCTCTAGCAGCAGGTTC), HPR_3_Fw (5’‐GCCCAGACATTGACTGGAGATG‐3’) and 18_HPR_Rv (5’‐GATGGTGGAATTCTACCTCTAGACTTGTA‐3’) (Xiao et al., 2018). Subsequently, the transcribed cDNA was used as a template in PCR using GoTaq® Green Master Mix (Promega) with the same primers used in cDNA synthesis for either segment 5 or 6.…”

Section: Methodsmentioning

confidence: 99%

Rapid sequence modification in the highly polymorphic region (HPR) of the hemagglutinin gene of the infectious salmon anaemia virus (ISAV) suggests intra‐segmental template switching recombination

Cárdenas

Galleguillos

Acevedo

et al. 2020

Journal of Fish Diseases

View full text Add to dashboard Cite

The ISAV has a genome composed of eight segments of (–)ssRNA, segment 6 codes for the hemagglutinin–esterase protein, and has the most variable region of the genome, the highly polymorphic region (HPR), which is unique among orthomyxoviruses. The HPR has been associated with virulence, infectivity and pathogenicity. The full length of the HPR is called HPR0 and the strain with this HPR is avirulent, in contrast to strains with deleted HPR that are virulent to varying degrees. The molecular mechanism that gives rise to the different HPRs remains unclear. Here, we studied in vitro the evolution of reassortant recombinant ISAV (rISAV) in Atlantic salmon head kidney (ASK) cells. To this end, we rescued and cultivated a set of rISAV with different segment 6‐HPR genotypes using a reverse genetics system and then sequencing HPR regions of the viruses. Our results show rapid multiple recombination events in ISAV, with sequence insertions and deletions in the HPR, indicating a dynamic process. Inserted sequences can be found in four segments of the ISAV genome (segments 1, 5, 6, and 8). The results suggest intra‐segmental heterologous recombination, probably by class I and class II template switching, similar to the proposed segment 5 recombination mechanism.

show abstract

The first instance of HPR-deleted ISAV detection in eviscerated, fresh salmon at a Chinese entry-exit port

Cited by 5 publications

References 21 publications

Infectious salmon anaemia virus detected by RT‐qPCR in Norwegian farmed rainbow trout, Oncorhynchus mykiss (Walbaum, 1792)

Infectious salmon anaemia virus detected by RT‐qPCR in Norwegian farmed rainbow trout, Oncorhynchus mykiss (Walbaum, 1792)

Wild and farmed salmon (Salmo salar) as reservoirs for infectious salmon anaemia virus, and the importance of horizontal- and vertical transmission

Rapid sequence modification in the highly polymorphic region (HPR) of the hemagglutinin gene of the infectious salmon anaemia virus (ISAV) suggests intra‐segmental template switching recombination

Contact Info

Product

Resources

About