The First Report of Tomato chlorotic spot virus (TCSV) Infecting Long Beans and Chili Peppers in the Dominican Republic

Abstract

The Dominican Republic has a significant area of the country cultivated with vegetables. In July 2013, in the provinces of Moca and La Vega, horticultural crops showed typical tospovirus symptoms (>30% incidence), including bronzing, chlorosis, necrosis, and ring spots on leaves and fruits. Samples were collected from potatoes (Solanum tuberosum), long beans (Vignaun guiculata), chili peppers (Capsicum frutescens), sweet peppers (C. annuum), and tomatoes (S. lycopersicum). Serological tests were clearly positive for infection by Tomato spotted wilt virus (TSWV) and/or related tospoviruses when tested with AgDia immunostrips. The viral RNA extracted from five plants per host was pooled to construct a cDNA library that was sequenced using an Illumina HiSeq 2000 platform. The paired-end reads were assembled using CLC Genomic Workbench version 6.0.3. The assembled contigs were submitted to BLASTx against a viral genome database. The results confirmed the presence of Tomato chlorotic spot virus (TCSV) and TSWV. Then, PCR tests were performed with primers pairs TSWV-LF 5′ CTGTTGTCTATTGAGGATTGTG 3′ AND TSWV-LR 5′ CAGAGAGCTTGTTAATGCAGGAC 3′ to amplify part of the TSWV L RNA, the pairs TCSV-SF 5′ AACTGGGAAAGCAGAAAACC 3′ and TCSV-SR 5′ CCTTACTCCGAACATTGCA 3′, and GRSV-SF 5′ CTGTCAGGAAAATCTTGACCTG 3′ and GRSV-SR 5′ CTTGACTCCAAACATCTCGT 3′ to detect part of the TCSV and Groundnut ringspot virus (GRSV) S segments. In the long bean and chili pepper samples from La Vega, only TCSV was detected (40% of the all samples) based on amplification of the expected size fragment with the S RNA specific primer pair. All the other samples were positive for TSWV and no GRSV was detected. The complete N gene of TCSV and TSWV were amplified using the primer pairs TCSV-NR2 5′ CACACTGAACTGAACTATAACACAC 3′ and TCSV-NF 5′ ACCTTGAATCATATCTCTCG 3′ and primers N-TSWV_FW 5′ TACGGATCCGATGTCTAAGGTTAAGCTCAC 3′ and N-TSWV_RV 5′ TTATCTCGAGTCAAGCAAGTTCTGCGAG 3′. The TCSV N protein sequences (KJ399303 and KJ399304) were 99% identical with the TCSV found in processing tomatoes in the Dominican Republic (1) and the United States (2). The TSWV N protein sequences (KJ399313, KJ399314 and KJ399315) shared 96 to 98% identity with the TSWV N sequences available. Dot blot hybridization tests (1) using DIG-labeled specific TCSV N gene probe confirmed TCSV infection in PCR-positive long bean and chili pepper samples, whereas no hybridization signal was detected for TSWV-infected tomatoes, potatoes, sweet peppers, or healthy samples. In addition, no reassortants were detected based on amplification of the expected size RNA fragments (3). These other amplicons (KJ399301, KJ399299, KJ399302, and KJ399300) showed 98% identity with the L and M segments of TCSV. Thrips collected from symptomatic plants were identified mainly as Frankliniella schultzei, consistent with the main thrips species transmitting TCSV. In the last two years, TCSV was reported in North and Central America and in the Caribbean Basin (1,2,4). These findings have an important epidemiological impact since TCSV represents a new threat to other horticultural crops affected by this tospovirus. References: (1) O. Batuman et al. Plant Dis. 98:286, 2014. (2) A. Londono et al. Trop. Plant Pathol. 37:333, 2012. (3) C. G. Webster et al. Virology 413:216, 2011. (4) C. G. Webster et al. Plant Health Progress. Online publication. doi:10.1094/PHP-2013-0812-01-BR, 2013.

Analyses of orthotospovirus populations and dispersion under different environmental conditions in Brazil and in the Dominican Republic

“…TCSV was also found infecting tobacco plants for the first time in the province of Santiago. Taken together, these findings clearly demonstrate that TCSV was introduced in the Dominican Republic, probably around five years ago (Almeida et al 2014;Martínez et al 2018) and was able to infect several crops and spread to different vegetablegrowing areas in the country. The transmission efficiency of TSWV and TCSV by the main thrips species present on the Island will likely determine which orthotospovirus will prevail.…”

“…The acquisition by TCSV of the M RNA region from GRSV could have influenced the recent spread of TCSV to North and Central America and to the Caribbean basin, including the Dominican Republic (Almeida et al 2014;Webster et al 2015;Londoño et al 2012;Martínez et al 2018), but that hypothesis remains to be proven.…”

“…In the Dominican Republic, TSWV was reported for the first time in 2009, simultaneously with the identification of F. occidentalis on the Island. Recently, with the introduction of new virus species, vegetable production has been threatened by orthotospovirus such as TCSV (Martínez et al 2013;Almeida et al 2014;Martínez et al 2018).…”

Analysis of the Defence Responses to Tomato Spotted Wilt Orthotospovirus (TSWV) and Hippeastrum Chlorotic Ringspot Orthotospovirus (HCRV) Infection in Capsicum Annuum Based on Transcriptome

“…Tomato spotted wilt orthotospovirus (TSWV) and Hippeastrum chlorotic ringspot orthotospovirus (HCRV) are orthotospoviruses that are transmitted by thrips (Thysanoptera) and are able to infect over 900 kinds of plant species within more than 90 families [2,3]. TSWV, Impatiens necrotic spot orthotospovirus (INSV) [4], Groundnut ringspot orthotospovirus (GRSV) [5], Watermelon silver mottle orthotospovirus (WSMoV), Tomato chlorotic spot orthotospovirus (TCSV) [6], Groundnut bud necrosis orthotospovirus (GBNV) [5], Pepper necrotic spot orthotospovirus (PNSV), Pepper chlorotic spot orthotospovirus (PCSV), Capsicum chlorosis orthotospovirus (CaCV) [7], Alstroemeria necrotic streak orthotospovirus (ANSV) [8], and Chilli yellow ringspot orthotospovirus (CYRSV) [9] can infect peppers, causing pepper leaf chlorosis, necrosis, concentric rings, necrotic spots, and pepper fruit deformity, which seriously affect yield and quality [10].…”

Integrating Local Lesion Assays with Conventional RT-PCR for Detection of Interspecies Tospovirus Reassortants and Mixed Tospovirus Infections

“…Since 2009, two additional tospoviruses emerged in Florida and the Caribbean: Groundnut ringspot virus (GRSV) and Tomato chlorotic spot virus (TCSV) (Londoño et al 2012;Webster et al 2010Webster et al , 2015. Previously reported only from South America and Africa, GRSV and TCSV have become significant pathogens of many of the same crops historically infected by TSWV in Florida and the Caribbean (Adegbola et al 2016;Almeida et al 2014;Batuman et al 2014;de Jensen and Adkins 2014;de Jensen et al 2017;González-Alvarez et al 2017;Martinez-Zubiaur et al 2016;Raid et al 2017;Webster et al 2013Webster et al , 2015. Sporadic findings elsewhere in the continental United States of GRSV (South Carolina and New York) and TCSV (Ohio) have been reported (Baysal-Gurel et al 2015;Webster et al 2015).…”