The genus Abrawayaomys Cunha and Cruz, 1979 (Rodentia: Cricetidae: Sigmodontinae): geographic variation and species definition

Percequillo, Alexandre Reis; Braga, Caryne; Brandão, Marcus Vinícius; Abreu-Júnior, Edson Fiedler de; Gualda-Barros, Juliana; Lessa, Gisele; Pires, Maria Rita Silvério; Hingst‐Zaher, Erika

doi:10.1093/jmammal/gyw228

Cited by 11 publications

(18 citation statements)

References 30 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…For Brucepattersonius samples we also used internal primers: BRUCE793R (5' ATTCTGGTTTAATGTGTGCTGG) and BRUCE664F (5' CTGATAAAATTCCATTCCACC). PCR reactions and cycle conditions were similar to described in Percequillo et al (2017). PCR products were purified using ExoSap-IT (Affymetrix) and sequenced using amplification primers and BigDye Terminator (Life Technologies Corp.), on ABI3130 sequencer (Applied Biosystems).…”

Section: Molecular Analysesmentioning

confidence: 99%

Small mammals of the Estação Ecológica de Bananal, southeastern Atlantic Forest, Brazil, with description of a new species of Brucepattersonius (Rodentia, Sigmodontinae)

Abreu-Júnior

Percequillo

2019

Arq. Zool.

Self Cite

View full text Add to dashboard Cite

The Atlantic Forest harbors an impressive diversity of nonvolant small mammals. Despite having been the target of many ecological and taxonomical studies in the last decades, this group is still poorly known in several aspects – basic information on intrapopulational morphologic variation and proper diagnoses are lacking for many species, even for common taxa. This is related to the fact that large series of specimens from a single locality are extremely rare in scientific collections. A consistent sampling effort was conducted at Estação Ecológica de Bananal, northeastern São Paulo State, throughout seven field expeditions between 2003 and 2011, under the coordination of the Museu de Zoologia da Universidade de São Paulo, resulting in extensive series of nonvolant small mammals. We studied in detail the external and cranio-dental morphology of this sample (575 specimens), that we assigned to 31 known species besides one new species to science. Most species belong to order Rodentia (26 species) from the families Cricetidae (22 species) and Echimyidae (four species); the remaining (six species) are marsupials from the order Didelphimorphia, family Didelphidae. This is one of the most diverse assemblages ever recorded in this biome, and includes some of the rarest endemic rodents of the Atlantic Forest, such as Abrawayaomys ruschii, Blarinomys breviceps, Drymoreomys albimaculatus, Phaenomys ferrugineus, Phyllomys kerri and Rhagomys rufescens. This outstanding richness can be explained by the extensive sampling effort performed for a long period of time. Also, the capture success of the third expedition (8.25%) is among the highest rates obtained in the Atlantic Forest and the extensive use of pitfall traps was fundamental for trapping this high number of species. Herein, we provide an annotated list of nonvolant small mammals occurring at Estação Ecológica de Bananal, with comprehensive analyses of morphological variation and detailed diagnoses that will allow their proper identification, and will provide a sound basis for a better comprehension of the geographic variation of these taxa across the biome. We also present a formal description for a new species of Brucepattersonius from the mountain ranges along the Paraíba do Sul valley. For five species of sigmodontine rodents, we investigate the levels of ontogenetic and sexual variation, and while the first is accentuate in all analyzed species the second does not contribute significantly to intrapopulation variation.

show abstract

Section: Molecular Analysesmentioning

confidence: 99%

Small mammals of the Estação Ecológica de Bananal, southeastern Atlantic Forest, Brazil, with description of a new species of Brucepattersonius (Rodentia, Sigmodontinae)

Abreu-Júnior

Percequillo

2019

Arq. Zool.

Self Cite

View full text Add to dashboard Cite

show abstract

“…No obstante, estos avances no han sido igualmente acompañados por estudios morfológicos de variación geográfica o de revisión de series extensas de especímenes de museos. En otros casos, estudios morfológicos detallados de unos pocos ejemplares, para géneros pobremente conocidos como Abrawayaomys o Juliomys (e.g., Pardiñas et al, 2008Pardiñas et al, , 2009aPercequillo et al, 2017), aportaron información valiosa para su mejor conocimiento.…”

Section: Taxonomíaunclassified

“…Pardiñas et al, 2009a). Más recientemente, este último taxón fue nuevamente incluido en la sinonimia de A. ruschii, sobre la base de evidencias morfológicas y moleculares (Percequillo et al, 2017). Taxones como Blarinomys breviceps o Thaptomys nigrita, dos Akodontini de hábitos semifosoriales, constituyen probablemente complejos de especies crípticas, al menos a juzgar por las evidencias moleculares (e.g., Silva Gomez, 2008;Ventura et al, 2012).…”

Section: Taxonomíaunclassified

“…Una problemática transversal a muchas de estas situaciones es el parcial desacople entre los estudios taxonómicos realizados en países vecinos -especialmente en Brasil-y aquellos efectuados en la Argentina, con las consecuentes limitaciones que esta situación impone. Afortunadamente esta tendencia ha comenzado a revertirse, poniendo de manifiesto la importancia de realizar estudios sistemáticos sin restricciones geográficas (e.g., De Almeida Chiquito et al, 2014;Percequillo et al, 2017).…”

Section: Taxonomíaunclassified

“…Un quinto endémite, Abrawayaomys chebezi, documentado para la provincia de Misiones y áreas adyacentes de Brasil (Pardiñas et al, 2009a(Pardiñas et al, , 2016, ha sido recientemente sinonimizado con A. ruschii del este Brasil (Percequillo et al, 2017), pese a que -según nuestro mejor entenderlas evidencias al respecto no sean concluyentes (Teta et al, en prensa).…”

Section: Diversidad Y Endemismosunclassified

See 2 more Smart Citations

Diversity, systematic and conservation of rodents from the southwestern end of the Interior Atlantic Forest.

Lanzone

Labaroni²,

Formoso³

et al. 2018

MACN

View full text Add to dashboard Cite

Diversity, systematic and conservation of rodents from the southwestern end of the Interior Atlantic Forest. We present a synthesis of the current knowledge of the rodents from the province of Misiones, Argentina, with emphasis on taxonomic, chromosomal, biogeographic and conservation issues. In this province, the order is represented by 7 families: Sciuridae (1 genus, 1 species), Cricetidae (17, 24), Caviidae (2, 2), Cuniculidae (1, 1), Dasyproctidae (1, 1), Echymyidae (3, 3) and Erethizontidae (1, 1). From 1 to 5 species-depending on taxonomic authorities-are endemic to Misiones. We briefly discuss some taxonomic problems, highlighting those questions that still persist (e.g., the complex situation of the genus Brucepattersonius). For several species, we provide novel chromosome data and compare it with the information available for Brazil. An analysis of the species richness at the provincial level indicates that the highest values for this parameter occur towards the south-central portion of the territory, in an area of interdigitation between the Interior Atlantic Forest and the ecoregion of Campos y Malezales. We discuss the role of large rivers in the region as barriers to the dispersal of this fauna (e.g., the Paraná between Argentina and eastern Paraguay). At least 9 species of rodents with distribution in the province of Misiones have been classified under some category of threat or near to the threat. In all cases, the survival of these taxa depends on maintaining the integrity and connectivity between forest remnants.

show abstract

Unraveling Deep Branches of the Sigmodontinae Tree (Rodentia: Cricetidae) in Eastern South America

et al. 2018

View full text Add to dashboard Cite

The genus Abrawayaomys Cunha and Cruz, 1979 (Rodentia: Cricetidae: Sigmodontinae): geographic variation and species definition

Cited by 11 publications

References 30 publications

Small mammals of the Estação Ecológica de Bananal, southeastern Atlantic Forest, Brazil, with description of a new species of Brucepattersonius (Rodentia, Sigmodontinae)

Small mammals of the Estação Ecológica de Bananal, southeastern Atlantic Forest, Brazil, with description of a new species of Brucepattersonius (Rodentia, Sigmodontinae)

Diversity, systematic and conservation of rodents from the southwestern end of the Interior Atlantic Forest.

Unraveling Deep Branches of the Sigmodontinae Tree (Rodentia: Cricetidae) in Eastern South America

Contact Info

Product

Resources

About