The HECT ubiquitin‐protein ligase (UPL) family in Arabidopsis: UPL3 has a specific role in trichome development

Abstract

SummaryAttachment of one or more ubiquitins (Ubs) to various intracellular proteins has a number of roles in plants including the selective removal of regulatory proteins by the 26S proteasome. The ®nal step in this modi®cation is performed by ubiquitin-protein ligases (E3s) that promote Ub transfer to appropriate targets. One important family of E3s is de®ned by the presence of a HECT domain, an active site ®rst found at the C-terminus of the human E3 (E6-AP). Using a consensus HECT domain as the query, we identi®ed a family of seven HECT-containing ubiquitin-protein ligases (UPL1±UPL7) in Arabidopsis thaliana that can be grouped into four subfamilies. The UPL3 and UPL4 subfamily encodes approximately 200-kDa proteins with four Armadillo repeats similar to those in the nuclear pore protein importin-a, suggesting that these E3s identify their targets through binding to nuclear localization sequences. Although T-DNA disruptions of the UPL3 locus do not affect overall growth and development of Arabidopsis, the mutants show aberrant trichome morphology. Instead of developing three branches, many upl3 trichomes contain ®ve or more branches. The upl3 trichomes also often undergo an additional round of endoreplication resulting in enlarged nuclei with ploidy levels of up to 64C. upl3 plants are hypersensitive to gibberellic acid-3 (GA 3 ), consistent with the role of gibberellins in trichome development. The phenotype of upl3 mutants is similar to that of kaktus, a previously described set of trichome mutants with supernumerary branches. Genetic analyses con®rmed that upl3 mutants and kaktus-2 are allelic with kaktus-2 plants harboring a splice-site mutation within the UPL3-transcribed region. Collectively, the data indicate that the ubiquitination of one or more activator proteins by UPL3 is necessary to repress excess branching and endoreplication of Arabidopsis trichomes.

Ubiquitination-mediated protein degradation and modification: an emerging theme in plant-microbe interactions

“…Like SCF E3s, the RING-type E3 ligases serve as scaffolds to bring together the activated ubiquitin-E2 and the substrate in promoting the transfer of ubiquitin to the substrate. In contrast to that only few HECT-type E3s are identified in plants [32], the SCF and the RING-type E3 are found in hundreds of proteins [33,34]. The U-box is a novel E3 ubiquitin ligase activity-related protein domain that was first identified in the yeast ubiquitination factor UFD2 [35].…”

Tripeptidyl Peptidase II. An Oligomeric Protease Complex from Arabidopsis

“…The first-strand cDNA was then PCR amplified using three sets of primer pairs for TPP2: set A (primer 2, TGCAGATTCACGGCGCGTTAATCAACAAAG and primer 3, CCAACTTGGAACCTACACGCCACTCTCC), set B (primer 4, GTG-TGGCATGATGGAGAAGTATGGAGGGTTG and primer 5, TCTCCATAGCT-CATGTTGACAAGATCACAG), and set C (primer 6, CAGACTATGGGCG-CTTTGTTGATCTTGTTAC and primer 7, TATCAACTTGCATAAGCCCTT-GTCCAGTAG); the position of each is identified left to right in Figure 2. The PAE2 primers are as described (Downes et al, 2003).…”

Arabidopsis ubiquitin ligase MIEL1 mediates degradation of the transcription factor MYB30 weakening plant defence

“…E3 proteins are classified into four main subfamilies depending on their structure and mechanism of action: HECT (Homologous to E6-associated protein C-Terminus), RING (Really Interesting New Gene), U-Box and cullin-RING ligases 6 . HECT proteins are unique because they form an Ub-E3 intermediate before transfer of Ub to the substrate 7 . RING and U-Box proteins are structurally related single polypeptides that respectively use zinc chelation and hydrogen bonds/salt bridges to transfer Ub from the Ub-E2 intermediate to the target 8,9 .…”