The HIF transcription network exerts innate antiviral activity in neurons and limits brain inflammation

Farahani, Ensieh; Reinert, Line S.; Narita, Ryo; Serrero, Manutea C.; Skouboe, Morten Kelder; van der Horst, Demi; Assil, Sonia; Zhang, Baocun; Iversen, Marie B.; Gutierrez, Eugenio; Hazrati, Hossein; Johannsen, Mogens; Olagnier, David; Kunze, Reiner; Denham, Mark; Mogensen, Trine H.; Lappe, Michael; Paludan, Søren R.

doi:10.1016/j.celrep.2024.113792

Cited by 3 publications

(4 citation statements)

References 67 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…ML228 was recently identified to exert antiviral activity in SH-SY5Y cells against HSV-1 and 2 in a manner dependent on autophagy. 55 We confirmed the autophagy-inducing activity of ML228 (Figure 3A and B). SH-SY5Y cells pretreated with ML288 for 2 h were infected with VZV rOka (MOI 0.005) or EMC-1 (MOI 0.01), according to optimization experiments showing optimal infection at these MOIs for the different VZV strains.…”

Section: Activation Of Autophagy Inhibits Vzv Gene Transcriptionsupporting

confidence: 69%

“…9 As a means of measuring autophagic flux, we also compared LC3-I to LC3-II conversion in the presence or absence of the late stage autophagy inhibitor chloroquine (CQ). To confirm these observations in cell types resembling neurons to a higher degree, we performed similar experiments in mature human neurons differentiated from SH-SY5Y neuroblastoma cells 56 (Figure 1E,F) and from human embryonic stem cells (hESC) 55,57 (Figure 1G,H). Importantly, both differentiated neuronal cell types exhibited neuron-like morphology (Fig.…”

Section: Vzv Infection Of Human Neuronal Cell Lines and Monocyte-deri...mentioning

confidence: 61%

“…Was done as previously described and further detailed in supplementary methods. 55,57 2.9 | Generation of knock-downs and knock-ins in SH-SY5Y cells Knock-down (KD) cell lines were generated by nucleofection with a CRISPR-Cas9 system following the manufacturer's instructions using the Amaxa 4D-Nucleofector protocol for SH-SY5Y cells (Lonza Cologne GmbH). gRNA AAVS1: GGGGCCACUAGGGACAGGAU, U LK1::GUCCUCGCUCAGCGUGCGCA, LC3B2: UUCAAGCAGCGCCG-CACCUU, ATG5: AAAAAGAUCACAAGCAACUC.…”

Section: Generation Of Hesc-derived Neuronsmentioning

confidence: 99%

“…PBMCs were isolated from whole blood by Ficoll density gradient centrifugation using SepMate PBMC isolation tubes (Stemcell Technologies, Vancouver, Canada) as described before 53 54 of VZV recombinant Oka strain = rOka strain (ATCC, VR-1832), the clinical isolate VZV EMC-1 or MeWoassociated VZV rOka/pOka or treated with stimuli indicated in the regarding figure and supplementary methods. 55…”

Section: Cell Culture Viral Infections and Stimulationsmentioning

confidence: 99%

See 3 more Smart Citations

Varicella zoster virus‐induced autophagy in human neuronal and hematopoietic cells exerts antiviral activity

Heinz,

Hinke,

Maimaitili

et al. 2024

Journal of Medical Virology

Self Cite

View full text Add to dashboard Cite

Autophagy is a degradational pathway with pivotal roles in cellular homeostasis and survival, including protection of neurons in the central nervous system (CNS). The significance of autophagy as antiviral defense mechanism is recognized and some viruses hijack and modulate this process to their advantage in certain cell types. Here, we present data demonstrating that the human neurotropic herpesvirus varicella zoster virus (VZV) induces autophagy in human SH‐SY5Y neuronal cells, in which the pathway exerts antiviral activity. Productively VZV‐infected SH‐SY5Y cells showed increased LC3‐I‐LC3‐II conversion as well as co‐localization of the viral glycoprotein E and the autophagy receptor p62. The activation of autophagy was dependent on a functional viral genome. Interestingly, inducers of autophagy reduced viral transcription, whereas inhibition of autophagy increased viral transcript expression. Finally, the genotype of patients with severe ocular and brain VZV infection were analyzed to identify potential autophagy‐associated inborn errors of immunity. Two patients expressing genetic variants in the autophagy genes ULK1 and MAP1LC3B2, respectively, were identified. Notably, cells of both patients showed reduced autophagy, alongside enhanced viral replication and death of VZV‐infected cells. In conclusion, these results demonstrate a neuro‐protective role for autophagy in the context of VZV infection and suggest that failure to mount an autophagy response is a potential predisposing factor for development of severe VZV disease.

show abstract

Section: Activation Of Autophagy Inhibits Vzv Gene Transcriptionsupporting

confidence: 69%

Section: Vzv Infection Of Human Neuronal Cell Lines and Monocyte-deri...mentioning

confidence: 61%

Section: Generation Of Hesc-derived Neuronsmentioning

confidence: 99%

Section: Cell Culture Viral Infections and Stimulationsmentioning

confidence: 99%

See 2 more Smart Citations

Varicella zoster virus‐induced autophagy in human neuronal and hematopoietic cells exerts antiviral activity

Heinz,

Hinke,

Maimaitili

et al. 2024

Journal of Medical Virology

Self Cite

View full text Add to dashboard Cite

show abstract

Lactate modulates microglial inflammatory responses through HIF-1α-mediated CCL7 signaling after cerebral ischemia in mice

Zhang,

Yang

et al. 2025

International Immunopharmacology

View full text Add to dashboard Cite

A review of HSV pathogenesis, vaccine development, and advanced applications

Bai,

Xu,

Zeng

et al. 2024

Mol Biomed

View full text Add to dashboard Cite

Herpes simplex virus (HSV), an epidemic human pathogen threatening global public health, gains notoriety for its complex pathogenesis that encompasses lytic infection of mucosal cells, latent infection within neurons, and periodic reactivation. This intricate interplay, coupled with HSV's sophisticated immune evasion strategies, gives rise to various diseases, including genital lesions, neonatal encephalitis, and cancer. Despite more than 70 years of relentless research, an effective preventive or therapeutic vaccine against HSV has yet to emerge, primarily due to the limited understanding of virus-host interactions, which in turn impedes the identification of effective vaccine targets. However, HSV's unique pathological features, including its substantial genetic load capacity, high replicability, transmissibility, and neurotropism, render it a promising candidate for various applications, spanning oncolytic virotherapy, gene and immune therapies, and even as an imaging tracer in neuroscience. In this review, we comprehensively update recent breakthroughs in HSV pathogenesis and immune evasion, critically summarize the progress made in vaccine candidate development, and discuss the multifaceted applications of HSV as a biological tool. Importantly, we highlight both success and challenges, emphasizing the critical need for intensified research into HSV, with the aim of providing deeper insights that can not only advance HSV treatment strategies but also broaden its application horizons.

show abstract

The HIF transcription network exerts innate antiviral activity in neurons and limits brain inflammation

Cited by 3 publications

References 67 publications

Varicella zoster virus‐induced autophagy in human neuronal and hematopoietic cells exerts antiviral activity

Varicella zoster virus‐induced autophagy in human neuronal and hematopoietic cells exerts antiviral activity

Lactate modulates microglial inflammatory responses through HIF-1α-mediated CCL7 signaling after cerebral ischemia in mice

A review of HSV pathogenesis, vaccine development, and advanced applications

Contact Info

Product

Resources

About