The Human Cytomegalovirus Protein pUL38 Suppresses Endoplasmic Reticulum Stress-Mediated Cell Death Independently of Its Ability To Induce mTORC1 Activation

Abstract

As obligate intracellular parasites, viruses not only hijack cellular machinery, they also deregulate host stress responses for their infection. Human cytomegalovirus (HCMV) modulates the endoplasmic reticulum (ER) stress response, due at least in part to the viral protein pUL38, and one of the consequences is to maintain the viability of infected cells. Consequently, pUL38-deficient virus induces premature cell death during infection. In addition, pUL38 activates mammalian target of rapamycin complex 1 (mTORC1), which may also antagonize other detrimental cellular stresses (N. J. Moorman et al., Cell Host Microbe 3:253-262, 2008). It remains elusive how pUL38 inhibition of cell death is related to mTORC1 activation. In this study, we defined the interplay of the two pUL38 activities. We constructed a series of pUL38 truncation mutants based on the secondary structure prediction and evolutionary conservation of its sequence. We found that the N-terminal 239 residues of pUL38 were necessary and sufficient to block cell death induced by pUL38-deficient virus or by the ER stress inducer tunicamycin. However, this pUL38 domain was unable to activate mTORC1 when expressed alone. Importantly, small-molecule inhibitors of mTORC1, rapamycin or torin 1, did not compromise pUL38 activity to block cell death in isolation or in virus infection. Expression of a constitutively active variant of an mTORC1 activator, Rheb (Ras homolog enriched in brain), could not prevent cell death induced by pUL38-deficient virus. Collectively, we provide genetic and biochemical evidence that pUL38 prevents ER stress-induced cell death independent of its role in mTORC1 activation.

Tuberous Sclerosis Complex Protein 2-Independent Activation of mTORC1 by Human Cytomegalovirus pUL38

“…Therefore, we determined if the N-terminal-truncated mutants of pUL38 retained the ability to activate mTORC1. We used S6K phosphorylation (phos-S6K) as an indicator of mTORC1 activation, as described previously (31). The ADpmUL38 mutant virus induced apparent S6K phosphorylation, consistent with our previous report that HCMV could activate mTORC1 in a pUL38-independent manner (31).…”

“…However, the mechanisms whereby pUL38 interacts with TSC2 to activate mTORC1 are unclear. We previously showed that the N-terminal 239 residues of pUL38 were necessary and sufficient to block premature cell death but were unable to activate mTORC1 in isolation, demonstrating that cell death inhibition by pUL38 was independent of its mTORC1 activation domain (31). In the present study, we further defined the TSC2-binding motif of pUL38 and showed that a TSC2-binding-deficient pUL38 mutant still was able to activate mTORC1.…”

“…pUL38 25-331 induces S6K phosphorylation without binding to TSC2 during HCMV infection. We previously showed that pUL38 suppressed cell death independently of its ability to induce mTORC1 activation (31). ADtrunHA-UL38 virus retained the ability to block cell death, but virus growth was reduced by about 10-fold.…”

“…We previously identified the domains or motifs responsible for the distinct activities of HCMV protein pUL38 by mutagenesis (31). Deletion of the first 56 residues was associated with rapid degradation of the protein, making it hard to dissect the structural and functional relationships of this region.…”

The ns12.9 Accessory Protein of Human Coronavirus OC43 Is a Viroporin Involved in Virion Morphogenesis and Pathogenesis

“…The infective full-length HCoV-OC43 cDNA clone pBAC-OC43-WT was kindly provided by Pierre J. Talbot (INRS-Institut Armand-Frappier, Québec, Canada). The pBAC-OC43-⌬ns12.9 cDNA clone was constructed in our laboratory by following a previously described protocol (29). Briefly, a cassette containing a stop codon at the fourth amino acid of the ns12.9 gene followed by the sequence with a selective kanamycin marker flanked by flippase recognition target (FRT) sites was amplified from the pYD-C191 plasmid with a pair of 70-nucleotide (nt) primers as the following primers: OC43-FRT-F (forward), 5=-CTAGCATTTGTTAAAGTTCTTAAGGCCACGC CCTATTAATGGACATTTGAAAGGACGACGACGACAAGTAA-3=; O C43-FRT-R (reverse), 5=-TCTGAGACATTAAAACCGTTAATATAA CGGAGATATTTCTTCTCAGGTCTACCACGTCGTGGAATGCC TTC-3=.…”