The human liver glutathione S-transferase gene superfamily: expression and chromosome mapping of an H<sub>b</sub>subunit cDNA

DeJong, Jeff; Chang, Chi Ming; Whang‐Peng, Jacqueline; Knutsen, Turid; Tu, Chen‐Pei D.

doi:10.1093/nar/16.17.8541

Cited by 98 publications

(39 citation statements)

References 37 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The cosmid therefore contains sequences from two genes and thus provides evidence that at least some human Mu class genes are clustered. This is consistent with previous studies of hybridization in situ identifying only two possible chromosomal localizations (DeJong et al, 1988;Islam et al, 1989) for this numerous multigene family.…”

Section: Characterization Of Human Class Mu Cosmid Sequencessupporting

confidence: 93%

“…mu3 79 tggctccttgggagggtccccag*gaa*ggagggctggg*ctt*tgggga 424 gagcaggc**********cctggtctcctctctgcccttgcatatgggaa The 3'-end of intron 2, through exons 3, 4 and 5 into intron 5, of the GSTmu3 gene are aligned with corresponding regions of the GSTmu2 gene, the rat su4 gene (Lai et al, 1988) and the human GSTmul cDNA (DeJong et al, 1988;Seidegird et al, 1988). Exons, in upper-case letters, are highlighted by the mul cDNA sequence; introns are in lower-case letters.…”

Section: Characterization Of Human Class Mu Cosmid Sequencesmentioning

confidence: 99%

See 1 more Smart Citation

Structure of human glutathione S-transferase class Mu genes

Taylor¹,

Oliver²,

Sherrington³

et al. 1991

Biochemical Journal

View full text Add to dashboard Cite

Nucleotide sequencing of a human cosmid clone shows that the exon-intron structures of a glutathione S-transferase multigene family are conserved between man and rat, that the human gene family is clustered and that gene conversion events have occurred within the cluster. In addition, between man and rat, there is a high degree of nucleotide sequence identity not only in exons but also in some introns. These conserved sequences are coincident with homologous sequences subject to gene conversion in both species, and hence the utilization of gene conversion by this gene family has itself been conserved. By using transient-expression assay the conserved/converted regions are shown to be capable of modulating transcriptional activity. The data suggest that DNA repair by gene conversion may be a chemical immunity mechanism. which could result in acquired resistance to toxins and, in particular, drug resistance due to glutathione S-transferase in tumours.

show abstract

Section: Characterization Of Human Class Mu Cosmid Sequencessupporting

confidence: 93%

Section: Characterization Of Human Class Mu Cosmid Sequencesmentioning

confidence: 99%

Structure of human glutathione S-transferase class Mu genes

Taylor¹,

Oliver²,

Sherrington³

et al. 1991

Biochemical Journal

View full text Add to dashboard Cite

show abstract

“…After prehybridization, the membranes were incubated with 32 P-labeled probes (10 6 cpm/mL) in 40 mmol/L phosphate buffer (pH 6.5), 4ϫ SSC, 40% formamide, 8ϫ Denhardt' s solution, and 10% Dextran for 16 hours at 42°C. Fragments of human CYP1A1, 11 CYP2E1, 8 CYP3A4, 12 mEH, 13 GST A1 cross-hybridizing with GST A2 (␣ class), 14 GST M1 (µ class), 15 and GST P1 ( class) 16 cDNAs were labeled with ␣-32 P-dCTP, while 28S oligonucleotide probe 17 was labeled with ␥-32 P-ATP. The posthybridization final wash was in 2ϫ SSC, 0.1% SDS, at 60°C for 15 to 30 minutes, after hybridization with CYP cDNA probes; in 1 to 0.1ϫ SSC, 0.1% SDS, at 42°C for 20 to 30 minutes, with mEH and GST cDNA probes; and in 2ϫ SSPE (pH 7.4), 0.1% Na 4 P 2 O 7 · 10H 2 O, 0.1% SDS, at 37°C for 30 minutes, with 28S oligonucleotide probe.…”

Section: Methodsmentioning

confidence: 99%

Phase I and Phase II drug-metabolizing enzymes are expressed and heterogeneously distributed in the biliary epithelium

et al. 1999

View full text Add to dashboard Cite

Tissue expression of drug-metabolizing enzymes influences susceptibility to drugs and carcinogens. Because the biliary epithelium, exposed to bile-borne chemicals, may give rise to drug-induced cholangiopathies and to cholangiocarcinomas, we determined the pattern of expression of drug-metabolizing enzymes in this epithelium. We first demonstrated by blot analyses that biliary epithelial cells (BEC) isolated from human gallbladders display cytochrome P450 (CYP) 1A, 2E1, and 3A, microsomal epoxide hydrolase (mEH), ␣, , and glutathione S-transferase (GST), transcripts and proteins. We also identified CYPassociated steroid 6␤-hydroxylase activity in BEC. CYP and mEH expression was 5-to 20-fold lower in BEC than in autologous hepatocytes, and further differed by a higher ratio of CYP3A5/CYP3A4, and by CYP1A1 predominance over CYP1A2. ␣GST was highly expressed in both hepatocytes and BEC, while GST was restricted to BEC. In approximately 50% of individuals, GST was expressed in hepatocytes and at lower levels in BEC. By using the same antibodies as those used in immunoblots, we could show by immunohistochemistry that CYP2E1, CYP3A, mEH, ␣, , and GST immunoreactivities are expressed and display a heterogeneous distribution in the epithelium lining the entire biliary tract except for small intrahepatic bile ducts that were devoid of CYP3A and ␣GST immunoreactivities. In conclusion, BEC contribute to phase II, and although to a lesser extent than hepatocytes, to phase I biotransformation. The distribution of drug-metabolizing enzymes in BEC suggest that they are heterogeneous in their ability to generate and detoxicate reactive metabolites, which may contribute to specific distributions of cholangiopathies. (HEPATOLOGY 1999;30:1498-1506.)Foreign compounds including procarcinogens and drugs are widely distributed in our environment. The liver is the major organ responsible for their biotransformation into more hydrophilic products, and elimination through bile secretion. Biotransformation results from the activities of phase I and phase II metabolizing enzymes that are mainly, although not exclusively, located within hepatocytes.

show abstract

“…This loss is caused by a gene deletion (4,10). The mRNA products of the GSTI-J and GSTI-2 alleles have been cloned (10,11). The two cDNA clones differ at a single base pair in the protein coding region.…”

mentioning

confidence: 99%

Cloning, expression, and characterization of a class-mu glutathione transferase from human muscle, the product of the GST4 locus.

Vorachek

Pearson

Rule

1991

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

A class-mu glutathione transferase cDNA clone, GTHMUS, was isolated from human myoblasts and its sequence was determined. The sequence predicts a protein of molecular weight 25,599 whose 24 amino-terminal residues are identical to those of the class-mu isoenzyme expressed from the GST4 locus. The GTHMUS cDNA shares 93.7% nucleotide sequence identity with a human liver cDNA clone, GTH411, that is encoded at the GSTJ locus. Comparison of the liver and muscle cDNA sequences shows two regions of remarkable sequence conservation: a 140-nucleotide region in the 5' coding portion of the molecule that has a single silent nucleotide substitution, and a 550-nucleotide region, including the entire 3' noncoding region, that has only three nucleotide substitutions or deletions. This sequence conservation suggests that gene conversion has occurred between the human GSTI and GST4 glutathione transferase gene loci. The human muscle and liver glutathione transferase clones GTHMUS and GTH411 have been expressed in Escherichia coli. The kinetic mechanism of the muscle enzyme was examined in product inhibition studies. The inhibition patterns are best modeled by a steadystate ordered bi-bi reaction mechanism. Glutathione is the first substrate bound and chloride ion is the first product released. Chloride ion inhibits the muscle enzyme.The glutathione transferases (RX: glutathione R-transferase, EC 2.5.1.18) are a family of proteins that detoxify chemical carcinogens, either by conjugating glutathione to reactive electrophilic sites or by direct binding (1,2). The soluble glutathione transferase enzymes have been grouped into three classes according to protein sequence similarity and antibody crossreactivity-alpha, mu, and pi (2). Members of the same class share 70-95% protein sequence identity, while interclass alignments show 25-30% sequence identity. These enzymes are abundant in mammalian liver. Class-alpha and -pi isoenzymes have been characterized from human, mouse, and rat liver. Genetic loci for six human glutathione transferase enzymes have been described: GSTJ-GST6 (3)(4)(5).

show abstract

The human liver glutathione S-transferase gene superfamily: expression and chromosome mapping of an H_bsubunit cDNA

Cited by 98 publications

References 37 publications

Structure of human glutathione S-transferase class Mu genes

Structure of human glutathione S-transferase class Mu genes

Phase I and Phase II drug-metabolizing enzymes are expressed and heterogeneously distributed in the biliary epithelium

Cloning, expression, and characterization of a class-mu glutathione transferase from human muscle, the product of the GST4 locus.

Contact Info

Product

Resources

About

The human liver glutathione S-transferase gene superfamily: expression and chromosome mapping of an Hbsubunit cDNA

Cited by 98 publications

References 37 publications

Structure of human glutathione S-transferase class Mu genes

Structure of human glutathione S-transferase class Mu genes

Phase I and Phase II drug-metabolizing enzymes are expressed and heterogeneously distributed in the biliary epithelium

Cloning, expression, and characterization of a class-mu glutathione transferase from human muscle, the product of the GST4 locus.

Contact Info

Product

Resources

About

The human liver glutathione S-transferase gene superfamily: expression and chromosome mapping of an H_bsubunit cDNA