The Mycobacterium bovis BCG Cyclic AMP Receptor-Like Protein Is a Functional DNA Binding Protein In Vitro and In Vivo, but Its Activity Differs from That of Its M. tuberculosis Ortholog, Rv3676

Abstract

Mycobacterium tuberculosisTuberculosis (TB) remains a global epidemic, with one-third of the world's population infected, 9 million active cases, and over 2 million deaths annually (3). Increased drug resistance and a lethal synergism with human immunodeficiency virus exacerbate the morbidity and mortality already associated with Mycobacterium tuberculosis infection (7, 9). The molecular pathogenesis of M. tuberculosis is poorly understood, and better characterization of the mechanisms by which the tubercle bacillus responds to its host environment is needed if we are to control this deadly infection.Cyclic AMP (cAMP), generated by adenylate cyclase, is an important signaling molecule in many bacterial species and eukaryotic cells. cAMP-mediated gene regulation in Escherichia coli, a process which requires interaction with the cAMP receptor protein (CRP), has been well defined (16). Additional roles for cAMP in metabolism have been reported for many pathogens (2,6,8,13,18,19,23,30,36), and recent studies increasingly point to an important role for cAMP signaling in microbial pathogenesis. Vfr, a CRP homolog in Pseudomonas aeruginosa, coordinates the expression of a variety of virulenceassociated factors including type IV pili and the type III secretion system (35). Mutation of a cyclase-encoding gene (cya) in Vibrio vulnificus resulted in attenuation of the bacterium, with a 100-fold increase in the 50% lethal dose for mice (15). Pathogenic fungi also use the highly conserved cAMP signal transduction pathway to regulate cellular differentiation and pathogenesis (20,21,31).The potential significance of cAMP signaling in M. tuberculosis pathogenesis was first explored in an early study that reported elevated levels of cAMP in the cytoplasms of macrophages infected with M. microti (24). Those authors correlated such increased cAMP levels with impaired phagosome-lysosome fusion. However, little more work was done on this topic until an in silico study identified genes for 15 adenylate cyclases and 10 cNMP-binding proteins in the M. tuberculosis genome (27). At least 10 of these adenylate cyclases are functional, as demonstrated by in vitro biochemical assays (33). It was recently shown that cAMP signaling is likely to be an important global regulator of gene regulation in M. tuberculosis and also that Rv3676 (CRP Mt ) is a CRP-like cAMP-responsive transcription factor with a putative regulon of more than 100 genes (4,32,34). Deletion of Rv3676 caused impaired growth in laboratory medium, in bone marrow-derived macrophages, and in a mouse model of TB (32).CRP Mt and its ortholog in M. bovis are identical. However, the Mycobacterium bovis BCG Pasteur ortholog, which we refer to as CRP BCG , contains two amino acid differences, L47P and E178K, relative to the CRP Mt sequence. It was recently reported that the L47P change resulted in loss of cAMP binding and that the E178K substitution caused a DNA binding defect in an E. coli model system (34). The authors proposed a role for CRP BCG in M. bovis BCG's attenuation based...

Two DHH Subfamily 1 Proteins in Streptococcus pneumoniae Possess Cyclic Di-AMP Phosphodiesterase Activity and Affect Bacterial Growth and Virulence

“…The recombinant proteins were purified using an Ni-nitrilotriacetic acid (NTA) resin (Qiagen) with buffers, as we previously reported (44,45). The protein concentrations were then determined using a BCA Protein Assay Kit (Thermo Scientific).…”

Expression of the Mycobacterium tuberculosis acr -Coregulated Genes from the DevR (DosR) Regulon Is Controlled by Multiple Levels of Regulation

“…The DNase I footprinting assay was performed as described previously (3). A 216-bp DNA fragment containing the acr-acg intergenic region was PCR amplified with primers KM511 (GGATCCGTCCGGCA TGATCAACCTCC) and KM506AЈ (GGATCCGGTGGCCATTTGATGCCT CC).…”

The Vitamin B 6 Biosynthesis Pathway in Streptococcus pneumoniae Is Controlled by Pyridoxal 5′-Phosphate and the Transcription Factor PdxR and Has an Impact on Ear Infection

“…A 32 P-end-labeled pdxS probe (0.01 pmol) was used in each 10-l binding reaction mixture as described previously (26,28), with modifications. Briefly, purified HisPdxR (at specified concentrations) and DNA probes were incubated for 30 min at room temperature in DNA binding buffer, followed by electrophoresis on a nondenaturing 8% polyacrylamide gel for 2 to 3 h at 14 V/cm in 0.5ϫ Tris-borate-EDTA (TBE) buffer.…”