The isolated muscle fibre as a model of disuse atrophy: Characterization using PhAct, a method to quantify f-actin

Abstract

Research into muscle atrophy and hypertrophy is hampered by limitations of the available experimental models. Interpretation of in vivo experiments is confounded by the complexity of the environment while in vitro models are subject to the marked disparities between cultured myotubes and the mature myofibres of living tissues. Here we develop a method (PhAct) based on ex vivo maintenance of the isolated myofibre as a model of disuse atrophy, using standard microscopy equipment and widely available analysis software, to measure f-actin content per myofibre and per nucleus over two weeks of ex vivo maintenance. We characterize the 35% per week atrophy of the isolated myofibre in terms of early changes in gene expression and investigate the effects on loss of muscle mass of modulatory agents, including Myostatin and Follistatin. By tracing the incorporation of a nucleotide analogue we show that the observed atrophy is not associated with loss or replacement of myonuclei. Such a completely controlled investigation can be conducted with the myofibres of a single muscle. With this novel method we can identify those features and mechanisms of atrophy and hypertrophy that are intrinsic to the muscle fibre from those that include activities of other tissues and systemic agents.

Muscle unloading: A comparison between spaceflight and ground‐based models

“…Apart from histological sections on frozen tissues, two other techniques to characterize myonuclei are single fibre isolation and in vivo time‐lapse imaging. In general, studies using single muscle fibres ex vivo do not report loss of myonuclei in HU and other atrophying conditions. Similarly, in vivo time‐lapse imaging has reported no loss of myonuclei in HU and other conditions causing muscle atrophy .…”

TGF-β–driven muscle degeneration and failed regeneration underlie disease onset in a DMD mouse model

“…Myofiber isolation, staining, and imaging. EDL muscle fibers were isolated following our previously described protocol (48,49). EDL muscle was carefully dissected and incubated in 0.2% collagenase type I (Sigma-Aldrich, C0130) for approximately 2 hours.…”

miR-411 is up-regulated in FSHD myoblasts and suppresses myogenic factors

“…Real-time PCR was performed with SYBR green Master Mix or TaqMan Universal PCR Master Mix (Life Technologies) using a final template concentration of 0.4 ng/μl. Myod , myogenin and Myh1 primers were a gift from Dr. Tatiana V. Cohen [66]. The primer sequences were as follows: Myod , 5 ′ - GGCTACGACACCGCCTACTA -3 ′ ; and 5 ′ - GCTCCACTATGCTGGACAGG -3 ′ .…”