The mallard duck (Anas platyrhynchos) as intermediate host for Sarcocystis wobeseri sp. nov. from the barnacle goose (Branta leucopsis)

Abstract

Morphometric and DNA investigation results of Sarcocystis wobeseri sp. nov. from the barnacle goose (Branta leucopsis) and Sarcocystis sp. (cyst type IV) from the mallard duck (Anas platyrhynchos) are presented. No significant morphometric differences between the investigated Sarcocystis species were found. ITS-1, 18S rRNA, and 28S rRNA gene sequences of these species showed 100% identity. The conclusion is drawn that it is one and the same Sarcocystis species in different intermediate hosts.

Description of Sarcocystis anasi sp. nov. and Sarcocystis albifronsi sp. nov. in birds of the order Anseriformes

“…However, only two species have specific names and are studied in depth, namely S. rileyi and S. wobeseri. Exhaustive information on S. rileyi is presented in several publications (Dubey et al 2003(Dubey et al , 2010Wicht 1981;Kutkienė et al 2011), whereas S. wobeseri is a recently described species, and thus far, it has been known only in Europe (Kutkienė et al 2010). In North America, as many as five types of sarcocysts in ducks (Drouin and Mahrt 1980) and two types in geese (Wobeser et al 1981) have been determined.…”

“…To the best of our knowledge, later, eight more Sarcocystis species parasitizing in birds were given names. They are as follows: S. otus from long-eared owl (Asio otus) (Krone et al 2000), S. lindsayi from budgerigars (Melapsittacus undulatus) (this species was described after a parrot had been infected with sporocysts excreted from the naturally infected opossum from Brazil) (Dubey et al 2001), S. ramphastosi and S. sulfuratusi from the keel-billed toucan (Ramphastos sulfuratus) (Dubey et al 2004), S. cornixi from the hooded crow (Corvus cornix) (Kutkienė et al 2009), Sarcocystis calchasi from the domestic pigeon (Columba livia f. domestica) (Olias et al 2010a), S. columbae from the wood pigeon (Columba palumbus) (Olias et al 2010b), and S. wobeseri from the barnacle goose (Branta leucopsis) (Kutkienė et al 2010).…”

“…For example, when investigating S. calchasi from the domestic pigeon and S. columbae from the wood pigeon, the same type 1 of tissue cyst wall was established, whereas genetic studies showed that these were different species of Sarcocystis (Olias et al 2010b). After genetic and ultrastructural studies of the sarcocysts have been carried out, the S. wobeseri species from the barnacle goose, which parasitizes the mallard duck too, was described (Kutkienė et al 2010). These two bird species belong to the Anseriformes order.…”

“…(cyst type III) ex Anser albifrons isolates were used in the molecular analysis. PCR conditions for ITS-1 region amplification were as described previously (Kutkienė et al 2010). Sequences were aligned using MUSCLE (Edgar 2004).…”

Recolonizing gray wolves increase parasite infection risk in their prey

“…Sarcocystis 18S rRNA gene amplification was performed using a set of three primer pairs (proti15F: 5′–TGCCAGTAGTCATATGCTTGTYT–3′, proti440R: 5′–CAGGCYCSCTCTCCGGA–3′ (Lesniak, Heckmann et al., 2017), SarAF: 5′–CTGGTTGATCCTGCCAGTAG–3′, SarAR: 5′–TTCCCATCATTCCAATCACT–3′, SarBF: 5′–GGGAGGTAGTGACAAGAAATAACAA–3′, SarBR: 5′–GGCAAATGCTTTCGCAGTAG–3′ (both primer pairs taken from Kutkiene et al. 2010) which anneal within conserved gene regions. Each forward and reverse oligonucleotide contained the Fluidigm‐specific common sequence tag CS1 (5′–ACACTGACGACATGGTTCTACA–[TS–For]–3′) or CS2 (5′–TACGGTAGCAGAGACTTGGTCT–[TS–Rev]–3′) to enable subsequent barcoding of the generated PCR products (Fluidigm, San Francisco, CA, USA).…”