The molecular basis of the human serum paraoxonase activity polymorphism

Humbert, Richard; Adler, David A.; Distèche, Christine M.; Hassett, Christopher; Omiecinski, Curtis J.; Furlong, Clement E.

doi:10.1038/ng0193-73

Cited by 771 publications

(583 citation statements)

References 37 publications

Supporting

Mentioning

554

Contrasting

Unclassified

Order By: Relevance

“…26,27 Briefly, (a) the CÀ108T SNP was amplified using primers GACC GCAAGCCACGCCTTCTGTGCACC and TGCAGCCG CAGCCCTGCTGGGGCAGCGCCGATTGGCCCGCCGC with 5% DMSO and an annealing temperature of 631C for 35 cycles. The 109 bp fragment was digested with BstUI, yielding 67 and 42 bp fragments in the presence of the C allele.…”

Section: Genotypingmentioning

confidence: 99%

“…26,27 Paraoxonase is the serum enzyme physiologically involved in protecting low-density lipoproteins (LDL) and high-density lipoproteins (HDL) from oxidation, and is responsible for OP inactivation in humans. 28,29 The three SNPs assessed here are the best-characterized functional polymorphisms affecting either the amount of serum paraoxonase or its affinity for specific substrates, ultimately leading to impressive interindividual differences in human serum paraoxonase activity.…”

Section: Introductionmentioning

confidence: 99%

“…28,29 The three SNPs assessed here are the best-characterized functional polymorphisms affecting either the amount of serum paraoxonase or its affinity for specific substrates, ultimately leading to impressive interindividual differences in human serum paraoxonase activity. [26][27][28][29] In particular, TÀ108 is associated with approximately 50% reduction in paraoxonase serum levels compared to CÀ108; 27 L/M55 alleles only marginally affect PON1 gene expression, but are in tight linkage disequilibrium (LD) with C/TÀ108 and Q/R192 alleles, respectively; 26,28,29 Q192 displays reduced affinity for chlorpyrifos, while R192 is significantly less active on diazinon in vitro. [26][27][28][29] This hypothesisdriven study therefore tests whether (a) CaucasianAmerican, and not Italian, families show a significant association between PON1 alleles and autism; (b) PON1 alleles associated with autism are those conferring reduced protection against OP exposure, by yielding either lower amounts of serum paraoxonase (TÀ108/M55) or possibly decreased affinity for diazinon (R192) or chlorphyrifos (Q192); and (c) there is evidence for potential gene-gene interactions between PON1 and RELN gene variants in autism pathogenesis.…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Paraoxonase gene variants are associated with autism in North America, but not in Italy: possible regional specificity in gene–environment interactions

et al. 2005

View full text Add to dashboard Cite

Organophosphates (OPs) are routinely used as pesticides in agriculture and as insecticides within the household. Our prior work on Reelin and APOE delineated a gene-environment interactive model of autism pathogenesis, whereby genetically vulnerable individuals prenatally exposed to OPs during critical periods in neurodevelopment could undergo altered neuronal migration, resulting in an autistic syndrome. Since household use of OPs is far greater in the USA than in Italy, this model was predicted to hold validity in North America, but not in Europe. Here, we indirectly test this hypothesis by assessing linkage/association between autism and variants of the paraoxonase gene (PON1) encoding paraoxonase, the enzyme responsible for OP detoxification. Three functional single nucleotide polymorphisms, PON1 CÀ108T, L55M, and Q192R, were assessed in 177 Italian and 107 Caucasian-American complete trios with primary autistic probands. As predicted, Caucasian-American and not Italian families display a significant association between autism and PON1 variants less active in vitro on the OP diazinon (R192), according to case-control contrasts (Q192R: v 2 ¼ 6.33, 1 df, Po0.025), transmission/disequilibrium tests (Q192R: TDT v 2 ¼ 5.26, 1 df, Po0.025), familybased association tests (Q192R and L55M: FBAT Z ¼ 2.291 and 2.435 respectively, Po0.025), and haplotype-based association tests (L55/R192: HBAT Z ¼ 2.430, Po0.025). These results are consistent with our model and provide further support for the hypothesis that concurrent genetic vulnerability and environmental OP exposure may possibly contribute to autism pathogenesis in a sizable subgroup of North American individuals.

show abstract

Section: Genotypingmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Paraoxonase gene variants are associated with autism in North America, but not in Italy: possible regional specificity in gene–environment interactions

et al. 2005

View full text Add to dashboard Cite

show abstract

“…Serum PON1 activity is influenced by environmental and genetic factors and varies among individuals in all populations. These variations in PON1 activity are mainly related to the expression of two polymorphisms located in the coding regions of the PON1 gene; Q192R (Q: glutamine, R: arginine) and L55M (L: leucine, M: methionine) [1,9,13,17,23,27]. Subsequent studies on polymorphisms contained in the promoter region of the PON1 locus have shown that the polymorphism located in the promoter region T(-107)C has a dominant effect on PON1 gene expression and enzymatic activity [5,14,22].…”

Section: Introductionmentioning

confidence: 99%

Effect of atorvastatin on paraoxonase1 (PON1) and oxidative status

Nagila

Permpongpaiboon

Tantrarongroj

et al. 2009

Pharmacological Reports

View full text Add to dashboard Cite

Abstract:It has been proposed that paraoxonase1 (PON1), a high density lipoprotein (HDL)-associated esterase/lactonase, has antiatherosclerotic properties. The activity of PON1 is influenced by PON1 polymorphisms. However, the influence of PON1 polymorphisms on PON1 activity and oxidative stress in response to lipid-lowering drugs remains poorly understood. The objective of the present study was to investigate the effects of atorvastatin on PON1 activity and oxidative status. The influence of PON1 polymorphisms on PON1 activity and oxidative status in response to atorvastatin treatment was also evaluated. In total, 22 hypercholesterolemic patients were treated with atorvastatin at a dose of 10 mg/day for 3 months. Lipid profile, lipid oxidation markers (malondialdehyde (MDA), conjugated diene (CD), total peroxides (TP)), total antioxidant substance (TAS), oxidative stress index (OSI), and paraoxonase1 activity were determined before and after treatment. L55M, Q192R, and T(-107)C PON1 polymorphisms were also determined. Atorvastatin treatment significantly reduced the levels of total cholesterol (24.5%), low density lipoprotein (LDL) cholesterol (25.4%), triglycerides (24.4%), CD (4.4%), MDA (15.2%), TP (13.0%) and OSI (24.0%), and significantly increased the levels of TAS (27.3%), and PON1 activity (14.0%). Interestingly, the increase in PON1 activity and the reduction in oxidative stress in response to atorvastatin were influenced only by the PON1 T-107C polymorphism. Atorvastatin treatment improved the lipid profile, lipid oxidation, and oxidative/antioxidative status markers including the activity of PON1 towards paraoxon. These beneficial effects may be attributed to the antioxidant properties of statins and the increase in PON1 activity. The increase in PON1 activity was enhanced by the PON1 T-107C polymorphism.

show abstract

“…This variability is attributed to environmental factors, such as smoking, diet, alcohol consumption, but also to the genetic polymorphisms in the PON1 gene. There are two annotated missense SNPs within the PON1 coding region: p.L55M (rs854560), where the major allele L leads to elevated PON1 protein levels, and p.Q192R (rs662), affecting substrate specificity as well as enzyme activity (Garin et al 1997;Humbert et al 1993). These two missense polymorphisms affect also the ability of HDL to protect LDL from oxidative modifications, with MM/QQ genotype being most effective (Mackness et al 1998a).…”

Section: Introductionmentioning

confidence: 99%

Regulatory regions of the paraoxonase 1 (PON1) gene are associated with neovascular age-related macular degeneration (AMD)

Oczos

Grimm

Barthelmes

et al. 2012

AGE

View full text Add to dashboard Cite

Physiological stress response and oxidative damage are factors for aging processes and, as such, are thought to contribute to neovascular age-related macular degeneration (AMD). Paraoxonase 1 (PON1) is an enzyme that plays an important role in oxidative stress and aging. We investigated association of DNA sequence variants (SNP) within the upstream regulatory region of the PON1 gene with neovascular AMD in 305 patients and 288 controls. Four of the seven tested SNPs (rs705379, rs705381, rs854573, and rs757158) were more frequently found in AMD patients compared to controls (P00.0099, 0.0295, 0.0121, and 0.0256, respectively), and all but one (SNP rs757158) are in linkage disequilibrium. Furthermore, haplotype TGGCCTC conferred protection (odds ratio (OR)00.76, (CI)00.60-0.97) as it was more frequently found in control individ- AGE (2013) uals, while haplotype CGATGCT increased the risk (OR01.55, CI01.09-2.21) for AMD. These results were also reflected when haplotypes for the untranscribed and the 5′untranslated regions (5′UTR) were analyzed separately. To assess haplotype correlation with levels of gene expression, the three SNPs within the 5′UTR were tested in a luciferase reporter assay. In retinal pigment epithelium-derived ARPE19 cells, we were able to measure significant differences in reporter levels, while this was not observed in kidney-derived HEK293 cells. The presence of the risk allele A (SNP rs705381) caused an increase in luciferase activity of approximately twofold. Our data support the view that inflammatory reactions mediated through anti-oxidative activity may be relevant to neovascular age-related macular degeneration.

show abstract

The molecular basis of the human serum paraoxonase activity polymorphism

Cited by 771 publications

References 37 publications

Paraoxonase gene variants are associated with autism in North America, but not in Italy: possible regional specificity in gene–environment interactions

Paraoxonase gene variants are associated with autism in North America, but not in Italy: possible regional specificity in gene–environment interactions

Effect of atorvastatin on paraoxonase1 (PON1) and oxidative status

Regulatory regions of the paraoxonase 1 (PON1) gene are associated with neovascular age-related macular degeneration (AMD)

Contact Info

Product

Resources

About