The multidrug resistance transporters CgTpo1_1 and CgTpo1_2 play a role in virulence and biofilm formation in the human pathogenCandida glabrata

Abstract

The mechanisms of persistence and virulence associated with Candida glabrata infections are poorly understood, limiting the ability to fight this fungal pathogen. In this study, the multidrug resistance transporters CgTpo1_1 and CgTpo1_2 are shown to play a role in C. glabrata virulence. The survival of the infection model Galleria mellonella, infected with C. glabrata, was found to increase upon the deletion of either CgTPO1_1 or CgTPO1_2. The underlying mechanisms were further explored. In the case of CgTpo1_1, this phenotype was found to be consistent with the observation that it confers resistance to antimicrobial peptides (AMP), such as the human AMP histatin-5. The deletion of CgTPO1_2, on the other hand, was found to limit the survival of C. glabrata cells when exposed to phagocytosis and impair biofilm formation. Interestingly, CgTPO1_2 expression was found to be up-regulated during biofilm formation, but and its deletion leads to a decreased expression of adhesin-encoding genes during biofilm formation, which is consistent with a role in biofilm formation. CgTPO1_2 expression was further seen to decrease plasma membrane potential and affect ergosterol and fatty acid content. Altogether, CgTpo1_1 and CgTpo1_2 appear to play an important role in the virulence of C. glabrata infections, being at the cross-road between multidrug resistance and pathogenesis.

Deletion of ADA2 Increases Antifungal Drug Susceptibility and Virulence in Candida glabrata

“…lence in C. glabrata is unclear. However, C. glabrata mutants, such as the tpo1_1 and tpo1_2 mutants, which have a reduced agar invasion ability compared with that of the wild type, show reduced virulence in a Galleria mellonella infection model (43). Further, the C. albicans fluconazole-resistant strain CO23 RFLC and the micafungin-resistant strain CO23 RFK , both of which are derived from the fluconazole-and micafungin-susceptible strain CO23 S , showed increased virulence in a murine model of systemic infection and formed branching hyphae that invaded the surface of the agar, unlike the hyphae formed by CO23 S , and that were longer than the hyphae formed by CO23 S (44), suggesting a possible relationship between increased virulence and agar invasion in both C. glabrata and C. albicans.…”

A Novel MFS Transporter Gene ChMfs1 Is Important for Hyphal Morphology, Conidiation, and Pathogenicity in Colletotrichum higginsianum

“…Complementation experiments using the wild-type sequences corresponding to the two T-DNA insertion genes showed that ChMfs1 alone is responsible for the phenotype of mutant Ch-1-T513. In human or animal pathogenic yeasts of Candida genus, a number of MFS transporters are well reported to be involved in host infection and virulence ( Costa et al, 2014 ; Shah et al, 2014 ; Santos et al, 2017 ). However, intra-hyphal hyphae were not found in MFS transporter deletion mutants.…”

Screening the Drug:H+ Antiporter Family for a Role in Biofilm Formation in Candida glabrata

“…In this study, the previously characterized multidrug transporters CgAqr1, CgQdr2, CgTpo1_1, CgTpo1_2, CgTpo3, CgFlr1_1, CgFlr1_2, and CgDrt1 transporters, as well as two others, CgTpo4 and CgYhk8, all belonging to the DHA1 family, were screened for a possible role in biofilm formation. This systematic screening was driven by the observation that the majority of the MFS transporters characterized so far appear to transport additional substrates beyond drugs (Costa et al, 2013a(Costa et al, ,b, 2014bPais et al, 2016aPais et al, , 2019, which affect C. glabrata pathogenesis and virulence Santos et al, 2017).…”

“…The cells were inoculated with an initial OD 600nm = 0,05 ± 0,005-corresponding to 5 × 10 5 CFU/ml-in 96-well polystyrene microtiter plates (Greiner) in either SDB (pH 5.6) or RPMI (pH 4) media. Cells were cultivated at 30 • C during CgQDR2_Rv CAACTTCAGATAGATCAGGACCATCA 15 ± 0,5 h with mild orbital shaking (70 rpm), as before (Melo et al, 2006;Pathak et al, 2012;Santos et al, 2017;Cavalheiro et al, 2019). After the incubation time, each well was washed three times with 200 µL of deionized water to remove cells not attached to the biofilm matrix.…”