The natural polyphenol curcumin induces apoptosis by suppressing STAT3 signaling in esophageal squamous cell carcinoma

Abstract

BackgroundWe and others have previously shown that the STAT3 signaling pathway is activated in some esophageal squamous cell carcinoma (ESCC) cells and is required for the survival and growth of these primary ESCC-derived xenografts. It has also been shown that the natural polyphenol curcumin is an effective anti-tumor agent.MethodsLuciferase assay and immunoblotting were performed to examine whether curcumin suppressed STAT3 signaling. CCK-8 assay and xenografts were utilized for analyzing ESCC cell growth in culture and mice. Soft agar assay was carried out to determine the colony formation ability of ESCC cells in the presence or absence of curcumin. Cell death and cell cycle were assessed by In CELL Analyzer 2000. Immunohistochemistry and TUNEL assay were used for detecting apoptosis in ESCC tisuses. Molecular docking was performed to evaluate the interaction of curcumin with JAK2. JAK2 activity was assessed using an in vitro cell-free system. HE staining was used to evaluate the ESCC tissues.ResultsThe natural polyphenol curcumin inhibited STAT3 phosphorylation rapidly and blocked STAT3-mediated signaling in ESCC cells. It also induced growth arrest and apoptosis in cultured ESCC cells, which were attenuated by enforced expression of STAT3. Furthermore, curcumin preferentially blocked the growth of primary ESCC-derived xenografts that harbored activated STAT3.ConclusionsCurcumin is able to exert anti-tumor action through inhibiting the STAT3 signaling pathway. Giving its wide use in traditional medicines with low toxicity and few adverse reactions, it is conceivable that curcumin might be further explored as a unique STAT3 inhibitor for anti-cancer therapies.

JAK-STAT Signaling: A Double-Edged Sword of Immune Regulation and Cancer Progression

“…Napabucasin has been demonstrated to sensitize tumor cells to checkpoint inhibition and it has been linked to high tumor infiltration of CD8 + T cells in mice bearing 4T1 mammary tumors [217], with similar results being reported in mesothelioma [218]. Notably, curcumin has demonstrated potent anti-STAT3 activity through STAT3 cysteine modification that prevents phosphorylation and it has been found to inhibit proliferation breast cancer [219] and esophageal squamous cell carcinoma [220], with the latter being associated with significant decreases in IL-6. However, while numerous studies using mice models have reported increases in TME infiltration by T cells, suppression of Tregs and MDSCs, and decreased NFκB signaling [221] in tumor bearing animals, curcumin has also been linked to the inhibition of DC activation [222,223].…”

Naturally occurring anti-cancer compounds: shining from Chinese herbal medicine

“…2) is a polyphenol compound extracted mainly from the rhizomes of Curcuma longa, Curcuma zedoaria and Acorus calamus L. with many biological activities, but it has poor water solubility and stability [11]. Clinical evidence and extensive studies showed that curcumin has various pharmacology effects, including anti-cancer, anti-inflammatory, and anti-oxidative activities [12][13][14]. Curcumin and its analogues are shown to be emerging as effective agents for the treatment of several malignant diseases such as cancer.…”

“…Curcumin inhibits cell growth, induces cell cycle arrest and apoptosis in esophageal squamous cell carcinoma EC1, EC9706, KYSE450, TE13 cells through STAT3 activation [12]. It also induces oxidative stress, which disrupts the mitochondrial membrane potential and causes the release of cytochrome c, thus inducing apoptosis [26].…”

Ubiquitin‐specific protease 44 inhibits cell growth by suppressing AKT signaling in non‐small cell lung cancer

“…To determine the mRNA levels of USP44, qRT‐PCR was performed by using SYBR Green qPCR Master Mix (Clontech Laboratories, Inc., Fitchburg, WI) as described previously . The primers used were as follows: USP44, forward 5′‐ ACAACTTATGATATGCCACC ‐3′ and reverse 5′‐ GATTTCCTCAAAGCCAAC ‐3′; GAPDH, forward 5′‐ GCACCGTCAAGGCTGAGAAC ‐3′ and reverse 5′‐ TGGTGAAGACGCCAGTGGA‐ 3′.…”

“…To determine the mRNA levels of USP44, qRT-PCR was performed by using SYBR Green qPCR Master Mix (Clontech Laboratories, Inc., Fitchburg, WI) as described previously. 15 The primers used were as follows:…”