The Occurrence and Characterization of New Recombinant Isolates of PVY Displaying Shared Properties of PVY^NW and PVY^NTN

Abstract

Isolates of Potato virus Y (PVY), collected in Syria, induced vein necrosis in tobacco but reacted to PVYO monoclonal antibody, and were therefore classified as PVYNW (or PVYN:O). The possible recombinant points within the genome were checked using a previously reported multiplex RT‐PCR. These isolates were categorized in two groups according to recombinant points. Isolates with one recombinant point at the HC‐Pro/P3, identical to previously reported PVYNW (or PVYN:O), were designated as group 1. However, the majority of Syrian PVY isolates showed two recombinant points at both HC‐Pro/P3 and 6K2/NIa, revealing a new genomic recombination pattern that had never been reported for PVYNW (or PVYN:O), hereafter referred to as group 2. Further characterizations showed that isolates of group 2 had an additional recombinant point at the N‐terminal of the coat protein gene (CP) of their genome. Based on the bioassay on tobacco, serological and molecular studies, these isolates showed shared characteristics of both PVYNW and the recombinant PVYNTN, making it difficult to include them in any of these variants. We propose them as new isolates of PVYN strain, and label them PVYSYR (SYR is from Syria, the country of origin).

Identification of the Molecular Make-Up of the Potato virus Y Strain PVYZ: Genetic Typing of PVYZ-NTN

“…These emerged during the last three decades and are now distributed worldwide (2,7,10,12,(19)(20)(21)25,36,41,43,45,48,51,52,56,67). In addition to the five PVY strains defined genetically on potato indicators, two main variants within the PVY N group (PVY NTN and PVY N-Wi ) were defined.…”

Occurrence of Potato virus Y strain PVYNTN in foundation seed potatoes in Japan, and screening for symptoms in Japanese potato cultivars

“…To identify the strain type, the multiplex PCR assay reported previously (Chikh Ali et al ., ) was used to test randomly selected PVY‐positive potato samples, collected during the field inspection or postharvest indexing. The full‐length genome sequence was determined for Eu‐12Jp excluding the primer site at the 5′ terminus, as reported previously (Chikh Ali et al ., ). To determine the 3′ end of Eu‐12Jp, the reverse primer Oligo‐dT/SacI [TACATgagctc(T)18] was used along with FY‐2 (5′‐AAGAGCCTTCACTGAAATGATG‐3′) to amplify the 3′ terminal segment.…”

“…This would suggest a general lack of connection between the PTNRD syndrome and a characteristic recombinant genomic structure of PVY NTN . Isolates of PVY NTN have been reported from most potato production areas of the world (Beczner et al ., ; Le Romancer et al ., ; Kerlan et al ., ; Boonham et al ., ; Glais et al ., ; Boukhris Bouhachem et al ., ; Chikh Ali et al ., ; Karasev et al ., ; Hu et al ., ; Visser & Bellstedt, ).…”

“…Based on genetic reactions in tobacco and potato indicators carrying the resistance genes Ny , Nc and Nz , potato isolates of PVY have been classified into five strain groups, PVY O , PVY C , PVY N , PVY Z and PVY E (Jones, ; Kerlan et al ., , ; Singh et al ., ; Galvino‐Costa et al ., ). In addition, based on molecular genome structure, several strains of PVY have been defined including PVY NTN , PVY NA‐N , PVY N‐Wi , PVY N:O and PVY NTN‐NW (Beczner et al ., ; Chrzanowska, ; Le Romancer et al ., ; Piche et al ., ; Crosslin et al ., ; Chikh Ali et al ., , ; Singh et al ., ; Hu et al ., ,b; Kerlan et al ., ). The name PVY NTN was originally used to describe PVY isolates able to induce potato tuber necrotic ringspot disease (PTNRD) in susceptible cultivars (Le Romancer et al ., ; Singh et al ., ).…”

Significance of weed hosts for Potato virus Y protection in Syria

“…The majority of PVY isolates from Syria were represented by a novel isolate, namely SYR‐NB‐16 that did not completely fit to any of above mentioned strains and variants. SYR‐NB‐16 reacted to PVY O monoclonal antibodies, induced veinal necrosis in tobacco, and had a recombinant genome of PVY NTN and PVY N W and thus such isolates including SYR‐NB‐16 were provisionally classified as PVY SYR (Chikh Ali et al ., 2007).…”