The OncoPPi network of cancer-focused protein–protein interactions to inform biological insights and therapeutic strategies

Abstract

As genomics advances reveal the cancer gene landscape, a daunting task is to understand how these genes contribute to dysregulated oncogenic pathways. Integration of cancer genes into networks offers opportunities to reveal protein–protein interactions (PPIs) with functional and therapeutic significance. Here, we report the generation of a cancer-focused PPI network, termed OncoPPi, and identification of >260 cancer-associated PPIs not in other large-scale interactomes. PPI hubs reveal new regulatory mechanisms for cancer genes like MYC, STK11, RASSF1 and CDK4. As example, the NSD3 (WHSC1L1)–MYC interaction suggests a new mechanism for NSD3/BRD4 chromatin complex regulation of MYC-driven tumours. Association of undruggable tumour suppressors with drug targets informs therapeutic options. Based on OncoPPi-derived STK11-CDK4 connectivity, we observe enhanced sensitivity of STK11-silenced lung cancer cells to the FDA-approved CDK4 inhibitor palbociclib. OncoPPi is a focused PPI resource that links cancer genes into a signalling network for discovery of PPI targets and network-implicated tumour vulnerabilities for therapeutic interrogation.

Development of a Time-Resolved Fluorescence Resonance Energy Transfer Ultrahigh-Throughput Screening Assay for Targeting the NSD3 and MYC Interaction

“…In a PPI network mapping study, our group has recently identified MYC as one of the interaction proteins of NSD3. 10 Our discovery links NSD3 to an important transcription factor, MYC, implying a potential function of NSD3. The small molecule inhibitors of NSD3/MYC interaction could be a useful tool to understand the function of NSD3 protein under physiological and pathophysiological conditions for therapeutic development.…”

“…pFUW-VF vector for N-VF-tag was generated and described as before. 10 The HindIII/NheI and XhoI/KpnI sites of the modified pcDNA3.2/V5-DEST vector (g894t, t908g, a3182c, and c3243g) 19 were used, respectively, to generate N-and C-terminal epitope-tagged Gatewaycompatible destination vectors, including N-or C-Flag-, C-VF, and C-His6-tagged plasmids. A 10-amino acids flexible linker sequence [(Gly4Ser)2] was inserted between the Flag (GACTACAAGGACGACGATGACAAG), His6 (CATCACCAT-CACCATCAC), or VF and the gene cDNA.…”

“…Our data suggest that MYC interacts with NSD3 and the MYC/NSD3 interaction was validated in cancer cells under physiological conditions. 10 This interaction is mapped to the NSD3S fragment. NSD3S is sufficient to increase MYC transcriptional activity and stabilizes MYC protein levels, indicating a potential oncogenic role for NSD3/MYC protein-protein interaction (PPI).…”

New Approaches to Difficult Drug Targets: The Phosphatase Story

“…28 There is little doubt that these prototypes will be emulated with many other disease-associated protein-protein interactions. 16 …”

“…Abnormal protein-protein interactions are coupled to many human diseases. 16,17 Blocking or disrupting these protein-protein interactions represents a major biochemical challenge, because the interface covers a large surface area, often lacks defined pockets, and comprises weak processive contacts. [18][19][20][21][22] Advances in our knowledge about the precise nature of the interactions from x-ray cocrystals with ligands, the availability of more sophisticated chemical libraries, and the use of fragment-based nuclear magnetic resonance (NMR) molecule inhibitors of BCL-2 heterodimerization, such as navitoclax and venetoclax, have received U.S. Food and Drug Administration approval for use in the treatment of cancer.…”