The Osteogenesis Effect and Underlying Mechanisms of Local Delivery of gAPN in Extraction Sockets of Beagle Dogs

Abstract

A plastic and biodegradable bone substitute consists of poly (l-lactic-co-glycolic) acid and 30 wt % β-tricalcium phosphate has been previously fabricated, but its osteogenic capability required further improvement. We investigated the use of globular adiponectin (gAPN) as an anabolic agent for tissue-engineered bone using this scaffold. A qualitative analysis of the bone regeneration process was carried out using μCT and histological analysis 12 weeks after implantation. CBCT (Cone Beam Computed Tomography) superimposition was used to characterise the effect of the different treatments on bone formation. In this study, we also explored adiponectin’s (APN) influence on primary cultured human jaw bone marrow mesenchymal stem cells gene expressions involved in the osteogenesis. We found that composite scaffolds loaded with gAPN or bone morphogenetic protein 2 (BMP2) exhibited significantly increased bone formation and mineralisation following 12 weeks in the extraction sockets of beagle dogs, as well as enhanced expression of osteogenic markers. In vitro investigation revealed that APN also promoted osteoblast differentiation of primary cultured human jaw bone marrow mesenchymal stem cells (h-JBMMSCs), accompanied by increased activity of alkaline phosphatase, greater mineralisation, and production of the osteoblast-differentiated genes osteocalcin, bone sialoprotein and collagen type I, which was reversed by APPL1 siRNA. Therefore, the composite scaffold loaded with APN exhibited superior activity for guided bone regeneration compared with blank control or Bio-Oss® (a commercially available product). The composite scaffold with APN has significant potential for clinical applications in bone tissue engineering.

TRPM8 Channel Promotes the Osteogenic Differentiation in Human Bone Marrow Mesenchymal Stem Cells

“…The assays were performed in three technical replicates. The following primers were used for Alkaline phosphatase (ALPL) gen: forward 5′-CCCGCTTTAACCAGTGCAAC-3′; reverse 5′-GAGCTGCGTAGCGATGTCC-3′ (Hu et al, 2015 ). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (forward 5′-CAGAGTTAAAAGCAGCCCTGGT-3, reverse 5′ GAAGGTGAAGGTCGGAGTCAAC−3′) was used as a housekeeping gene for the normalization of data.…”

Adiponectin promotes human jaw bone marrow mesenchymal stem cell chemotaxis via CXCL1 and CXCL8

“…The informed consent was obtained from all the patients. The h‐JBMMSCs were obtained from patients undergoing orthognathic surgery and were identified based on positivity for CD73, CD90 and CD105 and negativity for CD34, CD11b, CD19, CD45 and HLA‐DR using flow cytometry . The osteoblast‐inducing conditional medium consisted of α‐MEM medium with 10% FBS, 10 nM dexamethasone, 10 mM β‐glycerophosphate and 50 μg/ml L‐ascorbic acid (Sigma‐Aldrich, St. Louis, MO, USA).…”

“…In our previous study, we showed that APN could promote the osteogenesis of extraction sockets of beagle dogs in vivo . In another in vitro study, APN was found to promote the osteogenesis of human jaw bone mesenchymal stem cells (h‐JBMMSCs) through the APPL1‐p38 MAPK signalling pathway .…”

Adipose, Bone, and Myeloma: Contributions from the Microenvironment

“…Overweight and obese individuals typically present with low levels of adiponectin and are at a greater risk of developing MM when compared to individuals of healthy weight [80, 81]. Mechanistically, deficiency in adiponectin hinders the biological actions of several signaling pathways that are essential to prevent growth, proliferation, migration, and drug resistance of MM cells [81], and adiponectin can alter bone turnover for net bone anabolic or catabolic effects [82, 83]. Hence the net effects of adiponectin on myeloma-induced bone disease and tumor burden remain controversial.…”