The prognostic index of m7G-related genes in CRC correlates with immune infiltration

Abstract

N7-methyladenosine (m7G) modifications have been the subject of growing research interest with respect to their relationship with the progression and treatment of various cancers. This analysis was designed to examine the association between m7G-related gene expression and colorectal cancer (CRC) patient outcomes. Initial training analyses were performed using the TCGA dataset, with the GSE28722 dataset then being used to validate these results. Univariate Cox analyses were initially conducted to screen out prognostic m7G-related genes, after which a LASSO approach was used to construct an m7G risk score (MRS) model. Kaplan–Meier curves, ROC curves, and Cox analyses were subsequently used to validate the prognostic utility of this model in CRC patients. The R maftools package was further employed to assess mutational characteristics in CRC patients in different MRS subgroups, while the ESTIMATE, CIBERSORT, and ssGSEA tools were used to conduct immune infiltration analyses. A WGCNA was then performed to identify key immune-associated hub genes. The EIF4E3, GEMIN5, and NCBP2 genes were used to establish the MRS model. Patients with high MRS scores exhibited worse overall survival than patients with low scores. In Cox analyses, MRS scores were independently associated with CRC patient prognosis. Patients with low MRS scores exhibited a higher tumor mutational burden and higher levels of microsatellite instability. In immune infiltration analyses, higher immune checkpoint expression and greater immune cell infiltration were also observed in patients with low MRS scores. WGCNA analyses further identified 25 CD8+ T cell infiltration-associated genes. These findings suggest that MRS values represent a useful biomarker capable of differentiating among CRC patients with different immunological features and prognostic outcomes, offering an opportunity to better determine which patients are likely to benefit from immune checkpoint inhibitor treatment.

M7G-related tumor immunity: novel insights of RNA modification and potential therapeutic targets

“…Clustering analysis performed in the context of CRC and ovarian cancers have revealed a heightened prevalence of Tregs within the high-risk patient cohort. This elevated accumulation of Tregs aligns with an associated decline in overall survival [90,96].…”

“…M1 polarization of macrophages were usually conventionally with favorable outcomes. The prognostic models of ovarian cancers, CRC, HCC and HNSCC based on m7G regulators indicated more recruitment of M1 macrophages in low-risk group of patients 85 , 96 , 115 , 126 . However, contradictory outcomes were observed in bladder cancers 107 , 127 .…”

TIMM17A overexpression in lung adenocarcinoma and its association with prognosis

“…Complementary DNA (cDNA) was synthesized using 20 μl of HiScript III RT SuperMix for qPCR (+gDNA wiper) (Vazyme, Nanjing), following the manufacturer's instructions. qRT-PCR was then performed as per the kit's guidelines to ensure accuracy and reproducibility 24 . In order to evaluate the expression levels of the target genes, specific primer sequences were utilized: GAPDH Forward: TGCACCACAACTGCTTAGC; GAPDH Reverse: GGCATGGACTGTGGTCATGAG; TIMM17A Forward: GCTCCACAGTTAGGAGGTAGC; TIMM17A Reverse: CTCCCGTTAAGGCACCACTT.…”

The role of RNA methylation in tumor immunity and its potential in immunotherapy

“…m1A negatively regulates the proliferation of CD8 + T effector cells in colon cancer [ 272 ]. Similarly, high expression of m7G is associated with decreased cytotoxic CD8 + T cell infiltration and increased M2 macrophage infiltration [ 69 , 128 , 273 ] (Fig. 4 ).…”