The Propeptide Domain of Membrane Type 1 Matrix Metalloproteinase Is Required for Binding of Tissue Inhibitor of Metalloproteinases and for Activation of Pro-gelatinase A

Abstract

Matrix metalloproteinases (MMPs, 1 matrixins) are a large family of neutral zinc endopeptidases, which display homologous structural features consisting of a N-terminal propeptide domain, a zinc-coordinated catalytic domain, and a C-terminal hemopexin-and vitronectin-like domain (1-3). During the process of activation of secreted latent MMPs in the pericellular and extracellular environment, conformational perturbation or limited proteolysis within the N-terminal propeptide domain causes a change in the molecule that disrupts the unpaired Cys-Zn 2ϩ interaction and frees the Zn 2ϩ to participate in proteolytic cleavage. The modified MMP then attacks the peptide sequence downstream of the PRCGVPD sequence in an autolytic manner and cleaves the propeptide, thus producing a lower molecular weight activated enzyme (popularly described as a cysteine switch or velcro mechanism (4)). Activation of MMPs is inhibited by a family of proteins collectively known as tissue inhibitors of metalloproteinases (TIMPs).Membrane-type matrix metalloproteinases (MT-MMPs) represent a newly described group of matrixins (5) that are widely but selectively distributed in tissues. As the name implies, MT-MMPs are localized to the plasma membranes of cells by a stretch of hydrophobic amino acids (transmembrane domain; Ref. 6) followed by a short cytoplasmic sequence. MT-MMPs have been the subject of great interest because of their role in activating a secreted MMP, pro-gelatinase A, at the cell surface (5). Expression of MT1-MMP in embryonic tissue (7) and in malignant tumors has been correlated with the degree of activated gelatinase A in these tissues.The mechanism of pericellular activation of pro-gelatinase A appears to involve the formation of a unique bimolecular complex between TIMP-2 and MT1-MMP (5, 8, 9). Our recent study (10) documented that the N-terminal domain of TIMP-2 binds avidly to the catalytic domain of MT1-MMP, thereby producing a complex on the cell surface. The C-terminal domain of progelatinase A then binds to the available C-terminal domain of TIMP-2 (stabilization site), forming a trimolecular complex (9). According to this theory, a second MT1-MMP molecule (not complexed to TIMP-2) then attacks a single bond in complexed pro-gelatinase A, which is followed by an autolytic cleavage (11,12), thus resulting in pro-gelatinase A activation. Excess TIMP-2 interferes with this activation mechanism by binding and inhibiting all available MT1-MMP molecules.A special feature of MT-MMPs, as well as stromelysin-3 (13), is a 10-residue insert immediately preceding the final processing site between the propeptide and catalytic domain, which harbors a paired basic amino acid cleaving enzyme recognition motif (RXKR) (5, 6). Unlike stromelysin-3, which is a secreted MMP, latent membrane-bound MT1-MMP does not appear to be attacked at the RRKR sequence by the propeptide convertasedependent pathway (furin) in MT1-MMP transformed COS cells (14), but is attacked and converted to the activated form when secreted as a C-terminal truncate...

Complex roles of tissue inhibitors of metalloproteinases in cancer

“…This dual binding brings proMMP-2 close to cell surface, where it can be activated by neighboring TIMP-2-free MT1-MMP molecules (Shofuda et al, 1998;Butler et al, 1998). It has been reported that the entire propeptide domain of MT1-MMP is required for the TIMP-2 binding and subsequent proMMP-2 activation (Cao et al, 1998). However, other study showed that TIMP-2 binds to active MT1-MMP but not to latent MT1-MMP (Hernandez-Barrantes et al, 2000).…”

Regulation of Membrane Type-1 Matrix Metalloproteinase Activation by Proprotein Convertases

“…In cooperation with other portions of the prodomain, the cysteinyl residue in this peptide is proposed to interact with the Zn 2ϩ atom of the catalytic site to act as a "lock" to maintain proteinase latency (Nagase and Woessner, 1999). Given the ability of MT1-MMP to process other MMP zymogens to their active forms (e.g., progelatinase A and procollagenase-3), to directly cleave a range of extracellular matrix molecules (Pei and Weiss, 1996;Ohuchi et al, 1997), and to regulate collagen turnover in vivo (Holmbeck et al, 1999;Zhou et al, 2000), increased attention has focused on the means by which proMT1-MMP is itself converted to a catalytically active species (Strongin et al, 1995;Cao et al, 1996Cao et al, , 1998Zucker et al, 1998).…”

“…COS-1 cells transfected with MT1-MMP cDNA have been reported to generate a single immunoreactive product tentatively identified as the pro form of the enzyme (Sato et al, 1994;Cao et al, 1996Cao et al, , 1998Zucker et al, 1998). However, after transient transfection with wild-type MT1-MMP cDNA, the hemopexin domain-specific polyclonal antisera detected three immunoreactive bands at ϳ63, 60, and 45 kDa (Figure 2, A and B).…”

“…The detection of a single MT1-MMP species whose molecular mass appears consistent with that predicted for the proenzyme has been widely described in COS cells as well as in endothelial cells and tumor cell lines (Sato et al, 1994;Cao et al, 1996Cao et al, , 1998Rajavashisth et al, 1999). However, the detected species was assumed to represent the pro form of MT1-MMP based solely on the predicted molecular mass for the unprocessed zymogen.…”

Distinct Roles for the Catalytic and Hemopexin Domains of Membrane Type 1-Matrix Metalloproteinase in Substrate Degradation and Cell Migration

“…Construction of Plasmids-Expression vectors including MT1-MMP, TIMP-1, -2, pMMP-2, and soluble MT1-MMP (sol.MT1) without transmembrane and cytoplasmic domains have been described in detail previously (18,21,22). MT⌬C lacking the cytoplasmic domain of MT1-MMP was generated by introducing a stop codon after Phe 562 based on a PCR strategy using the primer sets: forward primer, number 1563: 5Ј-3Ј: CACGAATTCCGGACCATGTCTCCCGCCCCAAGA and reverse primer, number 1929: 5Ј-3Ј: AAGAATTCTCAGAAGAAGAAGACTGC-AAG.…”