The RNA Chaperone Hfq Is Required for Virulence of Bordetella pertussis

Bibova, Ilona; Skopova, Karolina; Mašín, Jiří; Černý, Ondřej; Hot, David; Šebo, Peter; Večerek, Branislav

doi:10.1128/iai.00345-13

Cited by 42 publications

(45 citation statements)

References 66 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…How or why is more ACT translated and secreted in the rseA mutant? Bibova et al showed that in the absence of the RNA chaperone Hfq, less ACT was produced, suggesting that a small RNA posttranscriptionally controls ACT translation (21). However, we did not observe differential expression of hfq in our RNA-seq analysis (Table S1).…”

Section: Figcontrasting

confidence: 50%

“…However, we did not observe differential expression of hfq in our RNA-seq analysis (Table S1). In the same study, it was observed that loss of hfq resulted in decreased pertussis toxin gene and protein expression (21). Due to these observations, it does not seem likely that hfq is responsible for the inverted pertussis-toxinto-ACT expression that we observe in the PM18 strain.…”

Section: Figsupporting

confidence: 48%

“…Standard errors of the means was calculated based on the interval of the ΔC T of the three biological replicates. The following primer sequences used in this study were described in a study by Bibova et al (21): cyaF (CGAGGCGGTCAAGGTGAT), cyaR (GCGGAAGTTGGACAG ATGC), ptxAF (CCAGAACGGATTCACGGC), ptxAR (CTGCTGCTGGTGGAGACGA), bvgAF (AGGTCATCAATGC CGCCA), bvgAR (GCAGGACGGTCAGTTCGC), fhaBF (CAAGGGCGGCAAGGTGA), fhaBR (ACAGGATGGCGAA CAGGCT), rpoBF (GCTGGGACCCGAGGAAAT), and rpoBR (CGCCAATGTAGACGATGCC). The following primers for BP2497 were designed for this study: BP2497F (TCGGATCGCACCAATTACTTC) and BP2497R (CCTTGGCGATCAGCGAGTT).…”

mentioning

confidence: 99%

See 2 more Smart Citations

Modulation of Pertussis and Adenylate Cyclase Toxins by Sigma Factor RpoE in Bordetella pertussis

et al. 2017

View full text Add to dashboard Cite

Bordetella pertussis is a human pathogen that can infect the respiratory tract and cause the disease known as whooping cough. B. pertussis uses pertussis toxin (PT) and adenylate cyclase toxin (ACT) to kill and modulate host cells to allow the pathogen to survive and persist. B. pertussis encodes many uncharacterized transcription factors, and very little is known about their functions. RpoE is a sigma factor which, in other bacteria, responds to oxidative, heat, and other environmental stresses. RseA is a negative regulator of RpoE that sequesters the sigma factor to regulate gene expression based on conditions. In B. pertussis, deletion of the rseA gene results in high transcriptional activity of RpoE and large amounts of secretion of ACT. By comparing parental B. pertussis to an rseA gene deletion mutant (PM18), we sought to characterize the roles of RpoE in virulence and determine the regulon of genes controlled by RpoE. Despite high expression of ACT, the rseA mutant strain did not infect the murine airway as efficiently as the parental strain and PM18 was killed more readily when inside phagocytes. RNA sequencing analysis was performed and 263 genes were differentially regulated by RpoE, and surprisingly, the rseA mutant strain where RpoE activity was elevated expressed very little pertussis toxin. Western blots and proteomic analysis corroborated the inverse relationship of PT to ACT expression in the high-RpoE-activity rseA deletion strain. Our data suggest that RpoE can modulate PT and ACT expression indirectly through unidentified mechanisms in response to conditions.

show abstract

Section: Figcontrasting

confidence: 50%

Section: Figsupporting

confidence: 48%

mentioning

confidence: 99%

See 1 more Smart Citation

Modulation of Pertussis and Adenylate Cyclase Toxins by Sigma Factor RpoE in Bordetella pertussis

et al. 2017

View full text Add to dashboard Cite

show abstract

“…It may actively remodel the RNAs to melt inhibitory secondary structures and also may serve passively as a platform to allow sRNAs and mRNAs to sample potential complementarity (Waters and Storz, 2009). Besides, Hfq is frequently required to protect the sRNAs from cellular ribonucleases such as RNase E (Papenfort and Vanderpool, 2015), and for many intracellular and extracellular pathogens it is known that Hfq deficiency dramatically affects virulence and fitness ( Escherichia coli , Kulesus et al, 2008; V. alginolyticus , Deng et al, 2016; Klebsiella pneumoniae , Chiang et al, 2011; Pseudomonas aeruginosa , Sonnleitner et al, 2003; Bordetella Pertussis , Bibova et al, 2013). …”

Section: Classification Of Srnasmentioning

confidence: 99%

Role of Non-coding Regulatory RNA in the Virulence of Human Pathogenic Vibrios

et al. 2017

View full text Add to dashboard Cite

In recent decades, the identification of small non-coding RNAs in bacteria has revealed an important regulatory mechanism of gene expression involved in the response to environmental signals and to the control of virulence. In the family Vibrionaceae, which includes several human and animal pathogens, small non-coding RNAs (sRNAs) are closely related to important processes including metabolism, quorum sensing, virulence, and fitness. Studies conducted in silico and experiments using microarrays and high-throughput RNA sequencing have led to the discovery of an unexpected number of sRNAs in Vibrios. The present review discusses the most relevant reports regarding the mechanisms of action of sRNAs and their implications in the virulence of the main human pathogens in the family Vibrionaceae: Vibrio parahaemolyticus, V. vulnificus and V. cholerae.

show abstract

“…We now know that there are other pathways by which virulence is controlled in this genus (57)(58)(59)(60)(61), but how these pathways relate to one another and to Bvg is still to be fully determined. The Bvg system controls production of many bacterial proteins-importantly ACT and other virulence factorsand expression is downregulated in response to sulfate, nicotinic acid, and a shift to lower temperature (25°C).…”

Section: Discussionmentioning

confidence: 99%

Albumin, in the Presence of Calcium, Elicits a Massive Increase in Extracellular Bordetella Adenylate Cyclase Toxin

et al. 2017

View full text Add to dashboard Cite

Pertussis (whooping cough), caused by Bordetella pertussis, is resurging in the United States and worldwide. Adenylate cyclase toxin (ACT) is a critical factor in establishing infection with B. pertussis and acts by specifically inhibiting the response of myeloid leukocytes to the pathogen. We report here that serum components, as discovered during growth in fetal bovine serum (FBS), elicit a robust increase in the amount of ACT, and Ն90% of this ACT is localized to the supernatant, unlike growth without FBS, in which Ն90% is associated with the bacterium. We have found that albumin, in the presence of physiological concentrations of calcium, acts specifically to enhance the amount of ACT and its localization to the supernatant. Respiratory secretions, which contain albumin, promote an increase in amount and localization of active ACT that is comparable to that elicited by serum and albumin. The response to albumin is not mediated through regulation of ACT at the transcriptional level or activation of the Bvg two-component system. As further illustration of the specificity of this phenomenon, serum collected from mice that lack albumin does not stimulate an increase in ACT. These data, demonstrating that albumin and calcium act synergistically in the host environment to increase production and release of ACT, strongly suggest that this phenomenon reflects a novel hostpathogen interaction that is central to infection with B. pertussis and other Bordetella species.KEYWORDS Bordetella pertussis, RTX toxins, adenylate cyclase toxin, albumin, calcium P ertussis (whooping cough) is a respiratory illness caused by Bordetella pertussis that can be life-threatening, especially in infants. In 2012, the number of cases of whooping cough in the United States was the highest since 1960 despite high vaccine coverage (1). Limited duration of protection by acellular pertussis vaccines is a major factor in the resurgence of pertussis (2), and one approach to this problem is reformulation of the acellular vaccines to include additional B. pertussis antigens (3). Adenylate cyclase toxin (ACT) is a critical factor in establishing infection with B. pertussis and a documented protective antigen (4-6). In light of these features, this toxin is a leading candidate for inclusion in new acellular pertussis vaccines (7,8).ACT is a single polypeptide of 1,706 amino acid residues that constitute a protein of ϳ200 kDa (9-12). ACT belongs to the RTX (repeats-in-toxin) family of proteins and has two activities (13). The toxin function involves insertion of the adenylate cyclase (AC) catalytic domain into the cytoplasm of host cells, activation by the host protein calmodulin, and conversion of intracellular ATP into cyclic AMP (cAMP), resulting in dysregulation of signaling processes and depletion of ATP in the intoxicated cell (14, 15). At higher concentrations, ACT undergoes oligomerization to form pores in the

show abstract

The RNA Chaperone Hfq Is Required for Virulence of Bordetella pertussis

Cited by 42 publications

References 66 publications

Modulation of Pertussis and Adenylate Cyclase Toxins by Sigma Factor RpoE in Bordetella pertussis

Modulation of Pertussis and Adenylate Cyclase Toxins by Sigma Factor RpoE in Bordetella pertussis

Role of Non-coding Regulatory RNA in the Virulence of Human Pathogenic Vibrios

Albumin, in the Presence of Calcium, Elicits a Massive Increase in Extracellular Bordetella Adenylate Cyclase Toxin

Contact Info

Product

Resources

About