The RNA hairpin binder TRIM71 modulates alternative splicing by repressing MBNL1

Welte, Thomas; Tuck, Alex; Papasaikas, Panagiotis; Carl, Sarah H.; Flemr, Matyáš; Knuckles, Philip; Rankova, Aneliya; Bühler, Marc; Großhans, Helge

doi:10.1101/gad.328492.119

Cited by 36 publications

(67 citation statements)

References 60 publications

(118 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The guide RNA (gRNA) was designed using the CRISPR design web tools ( http://www.e-crisp.org/E-CRISP/ ) and targeted exon 1 of the LMNA/C gene. The annealed guide RNA-encoding DNA oligos (5’- CACCGGGTGGCGCGCCGCTGGGACG -3’ and 5’- AAACCGTCCCAGCGGCGCGCCACCC -3’) were ligated into the pC2P vector ( Welte et al, 2019 ), which encodes for hCas9 and possesses a puromycin resistance cassette. Cells were transfected with the resulting pC2P-gLMNA/C vector and selected with puromycin for 3 days.…”

Section: Methodsmentioning

confidence: 99%

Torsin ATPases influence chromatin interaction of the Torsin regulator LAP1

Luithle

Bos

Hovius

et al. 2020

eLife

View full text Add to dashboard Cite

The inner nuclear membrane is functionalized by diverse transmembrane proteins that associate with nuclear lamins and/or chromatin. When cells enter mitosis, membrane-chromatin contacts must be broken to allow for proper chromosome segregation; yet how this occurs remains ill-understood. Unexpectedly, we observed that an imbalance in the levels of the lamina-associated polypeptide 1 (LAP1), an activator of ER-resident Torsin AAA+-ATPases, causes a failure in membrane removal from mitotic chromatin, accompanied by chromosome segregation errors and changes in post-mitotic nuclear morphology. These defects are dependent on a hitherto unknown chromatin-binding region of LAP1 that we have delineated. LAP1-induced NE abnormalities are efficiently suppressed by expression of wild-type but not ATPase-deficient Torsins. Furthermore, a dominant-negative Torsin induces chromosome segregation defects in a LAP1-dependent manner. These results indicate that association of LAP1 with chromatin in the nucleus can be modulated by Torsins in the perinuclear space, shedding new light on the LAP1-Torsin interplay.

show abstract

Section: Methodsmentioning

confidence: 99%

Torsin ATPases influence chromatin interaction of the Torsin regulator LAP1

Luithle

Bos

Hovius

et al. 2020

eLife

View full text Add to dashboard Cite

show abstract

“…To test this hypothesis, we asked whether TRIM71 binds and stabilizes let-7 targets in ESCs. To this end, we analyzed a published data set which includes RNA-seq data from TRIM71 RNA-IP experiments in ESCs, accompanied by transcriptomics on several Trim71 mutant ESCs, including Trim71 KO ESCs, Trim71 RING mutant ESCs and Trim71 NHL mutant ESCs 23 . RING mutant ESCs harbor the E3 ligase-impairing mutation C12LC15A 14,27 , and NHL mutant ESCs contain an R738A point mutation which was previously shown to impair TRIM71's ability to bind RNA 46 .…”

Section: Trim71 Binds and Stabilizes Let-7 Mrna Targets In Escsmentioning

confidence: 99%

“…8F-H). We then used an available transcriptomic dataset of TRIM71 KO Huh7 cells 23 , and conducted co-expression network analysis ( Fig. 9A-B).…”

Section: Trim71 Binds and Stabilizes Let-7 Mrna Targets In Hcc Cellsmentioning

confidence: 99%

“…B) Co-expression network analysis for the indicated ESC lines using an available dataset (GSE134125) 23 revealed genes commonly downregulated in all Trim71 mutant ESCs (modules B, C, J and K, marked with a yellow asterisk). C) Overlap of TRIM71 RNA-IP data in ESCs (GSE134125) 23 Table 4). Genes found enriched (>2-fold) in TRIM71 RNA-IPs in HepG2 cells (green) were overlapped with genes downregulated in TRIM71 KO Huh7 cells (yellow) -overlap depicted in C -to find genes bound and stabilized by TRIM71.…”

Section: Electrophoretic Mobility-shift Assays (Emsa)mentioning

confidence: 99%

“…Table 5) to identify let-7 targets bound and stabilized by TRIM71 in HCC cells (orange). B) Co-expression network analysis for WT and TRIM71 KO Huh7 cells using an available dataset (GSE134125) 23 revealed genes downregulated in TRIM71 KO Huh7 cells (modules A-E marked with a yellow asterisk). C) Overlap of TRIM71 RNA-IP data in HepG2 cells 47 with gene expression data, showing the number of TRIM71-bound mRNAs in HCC cells within each module from B.…”

Section: Electrophoretic Mobility-shift Assays (Emsa)mentioning

confidence: 99%

See 2 more Smart Citations

The stem cell-specific protein TRIM71 inhibits maturation and activity of the pro-differentiation miRNA let-7 via two independent molecular mechanisms

Fernández

Mitschka

Ulas

et al. 2021

Preprint

View full text Add to dashboard Cite

The stem cell-specific RNA-binding protein TRIM71/LIN-41 was the first identified target of the pro-differentiation and tumor suppressor miRNA let-7. TRIM71 has essential functions in embryonic development and a proposed oncogenic role in several cancer types, such as hepatocellular carcinoma. Here, we show that TRIM71 regulates let-7 expression and activity via two independent mechanisms. On the one hand, TRIM71 enhances pre-let-7 degradation through its direct interaction with LIN28 and TUT4, thereby inhibiting let-7 maturation and indirectly promoting the stabilization of let-7 targets. On the other hand, TRIM71 represses the activity of mature let-7 via its RNA-dependent interaction with the RNA-Induced Silencing Complex (RISC) effector protein AGO2. We found that TRIM71 directly binds and stabilizes let-7 targets, suggesting that let-7 activity inhibition occurs on active RISCs. MiRNA enrichment analysis of several transcriptomic datasets from mouse embryonic stem cells and human hepatocellular carcinoma cells suggests that these let-7 regulatory mechanisms shape transcriptomic changes during developmental and oncogenic processes. Altogether, our work reveals a novel role for TRIM71 as a miRNA repressor and sheds light on the precise mechanistic dual regulation of let-7.

show abstract

Ubiquitin Dynamics in Stem Cell Biology: Current Challenges and Perspectives

Dieuleveult

Miotto

2020

BioEssays

View full text Add to dashboard Cite

Ubiquitination plays a central role in the regulation of stem cell self‐renewal, propagation, and differentiation. In this review, the functions of ubiquitin dynamics in a myriad of cellular processes, acting along side the pluripotency network, to regulate embryonic stem cell identity are highlighted. The implication of deubiquitinases (DUBs) and E3 Ubiquitin (Ub) ligases in cellular functions beyond protein degradation is reported, including key functions in the regulation of mRNA stability, protein translation, and intra‐cellular trafficking; and how it affects cell metabolism, the micro‐environment, and chromatin organization is discussed. Finally, unsolved issues in the field are emphasized and will need to be tackled in order to fully understand the contribution of ubiquitin dynamics to stem cell self‐renewal and differentiation.

show abstract

The RNA hairpin binder TRIM71 modulates alternative splicing by repressing MBNL1

Cited by 36 publications

References 60 publications

Torsin ATPases influence chromatin interaction of the Torsin regulator LAP1

Torsin ATPases influence chromatin interaction of the Torsin regulator LAP1

The stem cell-specific protein TRIM71 inhibits maturation and activity of the pro-differentiation miRNA let-7 via two independent molecular mechanisms

Ubiquitin Dynamics in Stem Cell Biology: Current Challenges and Perspectives

Contact Info

Product

Resources

About