The RNA helicase RHAU (DHX36) unwinds a G4-quadruplex in human telomerase RNA and promotes the formation of the P1 helix template boundary

Abstract

Human telomerase RNA (hTR) contains several guanine tracts at its 5′-end that can form a G4-quadruplex structure. Previous evidence suggests that a G4-quadruplex within this region disrupts the formation of an important structure within hTR known as the P1 helix, a critical element in defining the template boundary for reverse transcription. RNA associated with AU-rich element (RHAU) is an RNA helicase that has specificity for DNA and RNA G4-quadruplexes. Two recent studies identify a specific interaction between hTR and RHAU. Herein, we confirm this interaction and identify the minimally interacting RNA fragments. We demonstrate the existence of multiple quadruplex structures within the 5′ region of hTR and find that these regions parallel the minimal sequences capable of RHAU interaction. We confirm the importance of the RHAU-specific motif in the interaction with hTR and demonstrate that the helicase activity of RHAU is sufficient to unwind the quadruplex and promote an interaction with 25 internal nucleotides to form a stable P1 helix. Furthermore, we have found that a 5′-terminal quadruplex persists following P1 helix formation that retains affinity for RHAU. Finally, we have investigated the functional implications of this interaction and demonstrated a reduction in average telomere length following RHAU knockdown by small interfering RNA (siRNA).

Binding of G-quadruplexes to the N-terminal Recognition Domain of the RNA Helicase Associated with AU-rich Element (RHAU)

“…All DNA synthesis batches exhibited the same result. Extinction coefficients (⑀ 260 nm ) were calculated from the sequence using IDT SciTools (PrimerQuest program, Integrated DNA Technologies) and corrected for hyperchromicity using the absorption spectra at 20 and 80°C: hTR [1][2][3][4][5][6][7][8][9][10][11][12][13][14][15][16][17][18][19][20] (22) and dsRNA (HIV-1 trans-activation response element, GGUCUCUCUGGUUAAGCCAGAUCUGAGCCUG-GGAGCUCUCUGGCUAACUAGGGAACC) (29) controls were used.…”

“…Protein Expression and Purification-RHAU 53-105 was cloned, expressed, and purified as described previously (22) with a final polishing step of size exclusion chromatography on a Superdex 200 10/300 GL column (GE Healthcare) in 10 mM HEPES, pH 7.5, 150 mM sodium chloride (I ϭ 154 mM) after removal of the hexahistidine (His 6 ) tag by thrombin. Protein identity was confirmed by mass spectrometry.…”

“…N-terminal Domain of RHAU Mediates an Interaction with hTR-To investigate the interaction between the N-terminal domain of RHAU and hTR quadruplex, we focused on a short truncation of the domain (RHAU ) that contains the RSM (residues 54 -66) and can bind quadruplex in vitro (22) (Fig. 4A).…”

“…4A). We have previously demonstrated that endogenous RHAU co-immunoprecipitates with the hTR from HEK293T cell lysates (22). We tested the binding specificity of RHAU 53-105 by performing RNA interaction assays in HEK293T cell lysates with RHAU 53-105 purified prior to proteolytic removal of the N-terminal His 6 tag.…”

“…RHAU can also modulate quadruplex structures in the context of non-coding RNAs. We have previously demonstrated that RHAU associates with a G-quadruplex at the 5Ј-end of human telomerase RNA (hTR) and is capable of unwinding this quadruplex in vitro (22). Interestingly, RHAU can associate with hTR in the context of the telomerase holoenzyme, an interaction that correlates with telomerase activity (23,24).…”