The role and assembly mechanism of nucleoprotein in influenza A virus ribonucleoprotein complexes

Abstract

The nucleoprotein of negative strand RNA viruses forms a major component of the ribonucleoprotein complex that is responsible for viral transcription and replication. However, the precise role of nucleoprotein in viral RNA transcription and replication is not clear. Here we show that nucleoprotein of influenza A virus is entirely dispensable for replication and transcription of short viral RNA-like templates in vivo, suggesting that nucleoprotein represents an elongation factor for the viral RNA polymerase. We also find that the recruitment of nucleoprotein to nascent ribonucleoprotein complexes during replication of full length viral genes is mediated through nucleoprotein-nucleoprotein homo-oligomerisation in a “tail loop-first” orientation and is independent of RNA binding. This work demonstrates that nucleoprotein does not regulate the initiation and termination of transcription and replication by the viral polymerase in vivo and provides new mechanistic insights into the assembly and regulation of viral ribonucleoprotein complexes.

Host Restriction of Influenza Virus Polymerase Activity by PB2 627E Is Diminished on Short Viral Templates in a Nucleoprotein-Independent Manner

“…The plasmids expressing PB1, PB2, PA, and NP of influenza virus A/WSN/33, as well as plasmids expressing short (47-to 101-nucleotide [nt]) vRNA templates derived from segment 5, have been described previously (22,23). Similar plasmids expressing short vRNA templates were constructed by PCR mutagenesis, producing internally deleted vRNA templates derived from segment 5 (NP37 [5=-1-17:CTAG:1549 -1565-3=; the numbers indicate the nucleotide positions retained at the 5= and 3= ends, respectively, separated by a CTAG spacer]) and segment 6 (NA37 [5=-1-18:1390 -1409-3=], NA47 [5=-1-25:1387-1409-3=], and NA76 [5=-1-37:1370 -1409-3=]).…”

“…HEK-293T or DF1 cells were transfected, as described previously (22), with plasmids encoding PA and PB1, as well as PB2 627K/E and NP where relevant, and a plasmid expressing a vRNA template. Cells were harvested 48 h after transfection, and the isolated RNA was analyzed by primer extension (22).…”

“…HEK-293T or DF1 cells were transfected, as described previously (22), with plasmids encoding PA and PB1, as well as PB2 627K/E and NP where relevant, and a plasmid expressing a vRNA template. Cells were harvested 48 h after transfection, and the isolated RNA was analyzed by primer extension (22). Primers for detection of full-length viral segments 5 and 6, as well as short vRNA templates derived from segment 5, have been described previously (22,25).…”

“…Cells were harvested 48 h after transfection, and the isolated RNA was analyzed by primer extension (22). Primers for detection of full-length viral segments 5 and 6, as well as short vRNA templates derived from segment 5, have been described previously (22,25). To detect replication and transcription of segment 6-derived short vRNA templates, primers NA37ϩ (5= GAGTTTTTAAACTCCTGCTTTCGC 3=) and NA37Ϫ (5= GC GAAAGCAGGAGTTTAAAAACTC 3=) were used to detect mRNA and vRNA produced from the 37-nt template, while primers NAϩ (5= CATTT AAACTCCTGCTTTCGC 3=) and NAϪ (5= GTTCAAAAAACTCCTTG TTTC 3=) were used for the 47-and 76-nt templates.…”

<div>Phosphorylation of the viral coat protein regulates RNA virus infection</div>

“…96 Influenza A virus is an enveloped (−)-strand ssRNA virus and a member of the family Orthomyoxoviridae. The influenza A NP is a component of the RNP complex and its oligomerization is required for the transcription and replication of full-length RNA genome segments, [98][99][100][101] but it needs to remain in a monomeric state before the assembly of the RNP complex. 102,103 The NP was phosphorylated at multiple sites, and reversible phosphorylation of S165, located in the "groove" of the NP which interacts with the "tail loop" of another NP, meditates NP oligomerization.…”