The role of cysteine residues in structure and enzyme activity of a maize β‐glucosidase

Abstract

The maize Zm-p60.1 gene encodes a b-glucosidase that can release active cytokinins from their storage forms, cytokinin-O-glucosides. Mature catalytically active Zm-p60.1 is a homodimer containing five cysteine residues per a subunit. Their role was studied by mutating them to alanine (A), serine (S), arginine (R) or aspartic acid (D) using site-directed mutagenesis, and subsequent heterologous expression in Escherichia coli. All substitutions of C205 and C211 resulted in decreased formation and/or stability of the homodimer, manifested as accumulation of high levels of monomer in the bacterial expression system. Examination of urea-and glutathione-induced dissociation patterns of the homodimer to the monomers, HPLC profiles of hydrolytic fragments of reduced and oxidized forms, and a homology-based three-dimensional structural model revealed that an intramolecular disulfide bridge formed between C205 and C211 within the subunits stabilized the quaternary structure of the enzyme. Mutating C52 to R produced a monomeric enzyme protein, too. No detectable effects on homodimer formation were apparent in C170 and C479 mutants. Given the K m values for C170A/S mutants were equal to that for the wild-type enzyme, C170 cannot participate in enzyme±substrate interactions. Possible indirect effects of C170A/S mutations on catalytic activity of the enzyme were inferred from slight decreases in the apparent catalytic activity, k H cat . C170 is located on a hydrophobic side of an a-helix packed against hydrophobic aminoacid residues of b-strand 4, indicating participation of C170 in stabilization of a (b/a) 8 barrel structure in the enzyme. In C479A/D/R/S mutants, K m and k H cat were influenced more significantly suggesting a role for C479 in enzyme catalytic action.Keywords: b-glucosidase; cysteine residues; disulfide bridge; structure±fuction relationships.Current research on b-glucosidases of animals, plants and microorganisms has significant scientific, clinical and economic implications (reviewed in [1]). In plants, b-glucosidases have been implicated in various aspects of growth, productivity and defence, and reactions such as cyanogenesis related to food and feed toxicity. In addition, recent data indicate that plant b-glucosidases may be involved in the metabolism of plant hormones, whose storage forms occur as b-glucosides and are activated by b-glucosidases [2,3]. Thus, information on structure±function relationships in the b-glucosidases is of obvious importance for understanding their biological functions, and engineering their catalytic and molecular properties for industrial and field applications.b-Glucosidases catalyse the hydrolysis of aryl and alkyl-b-dglucosides as well as glucosides with only carbohydrate moieties (such as cellobiose). Catalysis involves two essential carboxylates, one acting as a proton donor and the other as a nucleophile [4]. Cleavage of the glucosidic bond results in retention of the configuration at the anomeric carbon atom.Plant b-glucosidases are classified into family 1 of glycos...

Aminocyclitols as Pharmacological Chaperones for Glucocerebrosidase, a Defective Enzyme in Gaucher Disease

“…Aminocyclitols 1 b-1 o were evaluated as pharmacological chaperones on the basis of their ability to induce the recovery of recombinant GlcCerase activity after thermal [20] or urea-induced enzyme denaturation. [21] In our hands, both experiments afforded comparable results (see Supporting Information) and, in all cases, the chaperone activity of the aminocyclitols was challenged against that of N-(n-nonyl)deoxynojirimycin (NNDNJ), a well-known pharmacological chaperone for GlcCerase. [20] Recovery of Imiglucerase activity was measured in the presence of increasing concentrations of aminocyclitol at different time incubations under thermal denaturation conditions, as illustrated in Figure 4 for compound 1 e.…”

Functional analysis of the aglycone‐binding site of the maize β‐glucosidase Zm‐p60.1

“…The QuickChange multi site‐directed mutagenesis system (Stratagene, La Jolla, CA, USA) was used to introduce the desired mutations into (His) 6 Zm‐p60.r , a recombinant derivative of native Zm‐p60.1 lacking the plastid targeting sequence in pRSET:: Zm‐p60.r described previously [13,19,20]. The mutagenic oligonucleotides were as follows: mutation F193A, 5′‐AGTTCCGTAGGACGCGGAAGTAAATGTGTC‐3′; mutation F200K, 5′‐CACCGACCTGGGGCTTTGACCCCAGTTCCGTAG‐3′; mutations F461L and F461L in P2, 5′‐CGTTCGGTGAAGCCGGCCAGCCATTCAAAGTTGTC‐3′; mutations W373K and W373K in P2, 5′‐GGGTACATGTAGATTTTTGGATTTCCCATAG‐3′; mutations F200K and F193A in P2, 5′‐GCACCGACCTGGGGCTTTGACCCCAGTTCCGTAGGACGCGGAAGTAAATGTCTGGGG‐3′ (substituted nucleotides are underlined).…”

An automated method to evaluate the enzyme kinetics of β‐glucosidases

“…The kinetic parameters for the hydrolysis of the artificial substrate pNPG by β‐glucosidase were also determined through assays that used manual pipetting to validate the automatic procedure. The chromogenic artificial substrate pNPG was used in a previously described procedure at a concentration range of 0.05–40 mM in 0.05 M citrate‐phosphate buffer (CP, pH 5.5) to estimate the enzyme's initial velocity . In the manual pipetting, 5 μL of reaction mixture (β‐glucosidase with pNPG) was dispensed into 30 μL of 0.2 M Na 2 CO 3 .…”