The roles of glucagon-like peptide-2 and the intestinal epithelial insulin-like growth factor-1 receptor in regulating microvillus length

Abstract

Microvilli are tiny projections on the apical end of enterocytes, aiding in the digestion and absorption of nutrients. One of their key features is uniform length, but how this is regulated is poorly understood. Glucagon-like peptide-2 (GLP-2) has been shown to increase microvillus length but, the requirement of its downstream mediator, the intestinal epithelial insulin-like growth factor-1 receptor (IE-IGF-1R), and the microvillus proteins acted upon by GLP-2, remain unknown. Using IE-IGF-1R knockout (KO) mice, treated with either long-acting human (h) (GLY2)GLP-2 or vehicle for 11d, it was found that the h(GLY2)GLP-2-induced increase in microvillus length required the IE-IGF-1R. Furthermore, IE-IGF-1R KO alone resulted in a significant decrease in microvillus length. Examination of the brush border membrane proteome as well as of whole jejunal mucosa demonstrated that villin was increased with h(GLY2)GLP-2 treatment in an IE-IGF-1R-dependent manner. Under both basal conditions and with h(GLY2)GLP-2 treatment of the IE-IGF-1R KO mice, changes in villin, IRTKS-1, harmonin, β-actin, and myosin-1a did not explain the decrease in microvillus length, in either the brush border or jejunal mucosa of KO animals. Collectively, these studies define a new role for the IE-IGF-1R within the microvillus, in both the signaling cascade induced by GLP-2, as well as endogenously.

Intraluminal nutrients acutely strengthen rat intestinal MRP2 barrier function by a glucagon‐like peptide‐2‐mediated mechanism

“…The participation of GLP‐2 in oleic acid effect was demonstrated using an immunoneutralization method, originally reported in a work linking GLP‐2 with adaptative intestinal growth secondary to streptozotocin‐induced diabetes 32 . This finding, supported by the effect of intravenously administered GLP‐2 on MRP2 activity (Figure 1C), constitutes a new item in the increasing list of GLP‐2 biological functions at the intestinal level 8,11,12,33‐36 . Regarding the molecular mechanism that follows GLP‐2 secretion, we first evaluated the participation of IGF‐1.…”

Requirement for the intestinal epithelial insulin‐like growth factor‐1 receptor in the intestinal responses to glucagon‐like peptide‐2 and dietary fat

“…Animals were housed in a 14‐hour light, 10‐hour dark cycle in the animal facility at the University of Toronto. Functional induction of the IE‐IGR‐1R KO was validated by a 69% decrease in the normal trophic crypt‐villus height response to treatment with h(GLY 2 )GLP‐2, as recently reported 29 . The University of Toronto Animal Care Committee approved all studies and all protocols followed the Canadian Council on Animal Care guidelines.…”

“…IE‐IGF‐1R KO mice, on a C57BL/6 background, were generated by crossing villin‐CreER T2+/ 0 and Igf1r flox/flox mice (in which the ligand‐binding domain encoded by exon 3 is floxed), 32,33 as previously described 27‐29 . Wild‐type and floxed Igf1‐1r alleles (5′‐ATCTTGGAGTGGTTGGGTCTGTTT‐3′ and 5′‐ATGAATGCTGGTGAGGGTTGTCTT‐3′), and the Cre allele (5′‐CCTGGAAAATGCTTCTGTCCG‐3′ and 5′‐CAGGGTGTTATAAGCAATCCCC‐3′) were analyzed by PCR.…”

“…Following induction, a cohort of mice was injected sc q24h for 11 days with h(GLY 2 )GLP‐2 (0.1 μg/g; American Peptide Company, Sunnyvale, CA, USA) or vehicle (PBS), with the final injection 3hr prior to euthanasia 27‐29 . The small intestine was dissected and flushed with cold PBS.…”

“…However, the precise mechanism underlying this effect is still unclear, as the GLP‐2 receptor is not located on the enterocytes,21‐23 thus necessitating the actions of downstream mediators. It has previously been shown that insulin‐like growth factor‐1 (IGF‐1) and the intestinal epithelial insulin‐like growth factor‐1 receptor (IE‐IGF‐1R) are required for GLP‐2‐induced increases in intestinal growth and proliferation, while the IE‐IGF‐1R has also been shown to be essential for the stimulatory effects of GLP‐2 on barrier function and microvillus length 24‐29 . Furthermore, although nitric oxide mediates the GLP‐2‐induced increase in CM production in hamsters, this does not appear to be the case in humans 30,31 .…”