The Selection of Marginal Zone B Cells Differs from That of B-1a Cells

Kretschmer, Karsten; Jungebloud, Anke; Stopkowicz, Jana; Kleinke, Tanja; Hoffmann, Reinhard; Weiß, Siegfried

doi:10.4049/jimmunol.171.12.6495

Cited by 22 publications

(15 citation statements)

References 37 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We show here that this process of CDR-H3 selection continues in the spleen and that B cells enriched for specific CDR-H3 sequence categories appear to either gain ready access to or are excluded from individual splenic B cell compartments. Our findings also confirm and extend previous observations that selection of B cells into the various compartments of the spleen can be influenced by V usage [17][18][19]. Collectively, these observations support the hypothesis that entry to the various peripheral B cell compartments is influenced by ligand selection [17,18,20,21] and further suggest that selective pressure may be exerted at the level of categories of antigenic epitopes.…”

Section: Discussionsupporting

confidence: 90%

See 1 more Smart Citation

Categorical selection of the antibody repertoire in splenic B cells

et al. 2007

View full text Add to dashboard Cite

In the bone marrow, the passage of developing B cells through critical checkpoints of differentiation is associated with a reduction of specific categories of CDR3 of the Ig heavy chain (CDR-H3), particularly those with excessive hydrophobic or charged amino acids and those with a length of eight or fewer residues. To gain insight into the role of CDR-H3 content in the development of B cells in the spleen, we compared the sequences of V H 7183DJCl transcripts from sorted transitional T1, marginal zone, and follicular B cell subsets to those expressed by immature IgM + IgD -and mature IgM lo IgD hi B cells in the bone marrow. Although differences in V H utilization were noted, the T1 CDR-H3 repertoire showed extensive similarity to that of immature bone marrow B cells, and the follicular CDR-H3 repertoire most resembled that of mature bone marrow B cells. Unlike the splenic follicular and bone marrow mature B cell CDR-H3 repertoires, the marginal zone B cell CDR-H3 repertoire retained both short and highly charged amino acid motifs, including those with two arginines. Our findings suggest that antigen binding sites containing specific categories of CDR-H3 sequence content may inhibit, permit, or even facilitate passage of the host B cell through critical checkpoints in peripheral as well as central development.

show abstract

Section: Discussionsupporting

confidence: 90%

“…A previously recognized feature of MZ is enrichment for short CDR-H3 [18,19]. Deconstruction of the sequences we obtained in this study revealed that shorter MZ CDR-H3 length cannot be attributed solely to an increased prevalence of sequences bearing the hallmarks of neonatal origin [24].…”

Section: Discussionsupporting

confidence: 53%

Categorical selection of the antibody repertoire in splenic B cells

et al. 2007

View full text Add to dashboard Cite

show abstract

Section: Introductionmentioning

confidence: 99%

“…cDNA from DNase1 treated RNA (Amersham Biosciences) was prepared using oligo-d(T) [12][13][14][15][16][17][18] (Amersham Biosciences) and Superscript II RNaseH − reverse transcriptase (Invitrogen) and further PCR amplified using HotstarTaq TM DNA polymerase (Qiagen) and following primers: Igμ/α VH region, for VHcons 5 GAGGTGCAG CTGCAGGAGTCTGG3 rev Cμ1/Cμ2 5 ATGGCCACCAGATTCT TATCAGA3 /5 CATTTGGGAAGGACTGA3 or Cα1/Cα2 5 ATCAGG CAGCCGATTATCAC3 /5 GAGCTGGTGGGAGTGTCAGTG3 . PCR conditions were: 94 • C for 20 s, annealing at 50 • C for 40 s.…”

Section: Rt-pcrmentioning

confidence: 99%

“…PEC of these mice contains almost exclusively CD5 + B-1a cells, while the development of conventional B-2 cells in BM is inhibited [15]. MZ B cells are also present in the spleen of L2 mice in addition to B-1a cells [16].The sequencing of transcribed heavy chains from PEC B-1a cell pool of L2 mice showed pronounced oligoclonality. In addition, some repertoire dominating sequences could be found repeatedly in different mice [17,18].…”

mentioning

confidence: 99%

See 1 more Smart Citation

B‐1‐cell subpopulations contribute differently to gut immunity

et al. 2013

Self Cite

View full text Add to dashboard Cite

IntroductionIgA is the major class of Ab present in mucosal tissues of mammals. IgA constitutes a key defense mechanism against invasion by inhaled or ingested pathogens. IgA is also found at significant concentrations in the serum of many species, where it mediates the elimination of pathogens that have breached the mucosa [1].Among the various MALTs, IgA-producing cells are present in highest numbers in GALTs constituted by Peyer's patches (PPs), isolated lymphoid follicles (ILFs), and solitary intestinal lymphoid Correspondence: Dr. Bishnudeo Roy e-mail: Bishnudeo.Roy@helmholtz-hzi.de tissue (SILT) [2,3]. B cells, present in the B-cell follicles of such organized structures, form GCs upon Ag encounter. Under the influence of various cellular and molecular factors -T cells and cytokines, for instance -these B cells are thought to switch from IgM to IgA [4].Multiple pathways of IgA induction have been reported. The T-cell-dependent pathway of IgA induction is well known and, it is clear that IgA can also be induced in T-cell-independent (TI) manner (e.g. in T-cell-deficient mice, CD40 −/− mice, CD28 −/− mice, etc.) [5][6][7]. However, the precise contribution of T-cell-dependent and TI pathways to IgA production is not known.An important contribution of B-1 cells to TI responses has been suggested [6,8,9]. Peritoneal cavity (PEC) B-1 cells have also been claimed to contribute significantly to IgA-producing plasma cell (PC) Eur. J. Immunol. 2013Immunol. . 43: 2023Immunol. -2032. Importantly, according to phenotype, origin, and function, PEC B-1 cells can be divided into B-1a and B-1b subpopulations [12,13]. Phenotypically, B-1a cells are characterized as B220 lo CD19 hi IgM hi IgD lo CD43 + Mac-1 + CD5 int . B-1b cells share all the aforementioned markers with B-1a cells except CD5. With respect to differential contribution of these two B-1-cell subtypes to IgA production, recently, we could show that most of the IgA-secreting cells in the PEC of unmanipulated mice belonged to B-1b-cell subpopulation [14]. Additionally, IgA-derived VH regions from B-1b cells also contained frequent single nucleotide exchanges indicative of somatic hypermutation (SHM) [14]. Thus, a contribution of PEC B-1b cells to IgA production and hence to gut-associated immunity is quite likely. However, in spite of evidential suggestions for the contribution of B-1 cells to the intestinal PC pool, their contribution under unmanipulated conditions remains uncertain. This is partly due to the lack of appropriate markers to distinguish PCs according to their origin. In this context, a sequence-based approach to address this question should become very useful.In the present work, to investigate the participation of PEC B-1 cells in the gut-associated IgA production we have made use of the transgenic mouse model known as the L2 mouse line [15]. Mice of this line are characterized by the expression of a transgenic λ light chain obtained from the plasmacytoma MOPC315 (λ2 315 ). PEC of these mice contains almost exclusively CD5 + B-1a cells, whi...

show abstract

Peritoneal and splenic B‐1 cells are separable by phenotypic, functional, and transcriptomic characteristics

et al. 2004

View full text Add to dashboard Cite

B-1 cells constitute a distinct B cell population with unique phenotypic and functional characteristics. Although the origin of B-1 cells remains controversial, B-1 cells in different locations are generally considered to be part of the same pool. To determine the validity of this assumption, we examined peritoneal and splenic B-1 cells isolated by flow cytometric cell sorting from normal mice for several features. We found that splenic B-1 cells differ from peritoneal B-1 cells in terms of surface antigen expression, viability ex vivo, immunoglobulin secretion in vitro, stimulated cell cycle progression, and expression of Notch family, Notchdependent, and Notch-associated genes. These results indicate that splenic and peritoneal B-1 cells are not the same and thus dispute the notion that B-1 cells are uniform, and may suggest that different subpopulations of B-1 cells arise separately, home individually, and/or are heavily influenced by local environmental factors.

show abstract

The Selection of Marginal Zone B Cells Differs from That of B-1a Cells

Cited by 22 publications

References 37 publications

Categorical selection of the antibody repertoire in splenic B cells

Categorical selection of the antibody repertoire in splenic B cells

B‐1‐cell subpopulations contribute differently to gut immunity

Peritoneal and splenic B‐1 cells are separable by phenotypic, functional, and transcriptomic characteristics

Contact Info

Product

Resources

About