The small leucine-rich repeat secreted protein Asporin induces eyes in Xenopus embryos through the IGF signalling pathway

Abstract

Small leucine-rich repeat proteoglycan (SLRP) family proteins play important roles in a number of biological events. Here, we demonstrate that the SLRP family member Asporin (ASPN) plays a crucial role in the early stages of eye development in Xenopus embryos. During embryogenesis, ASPN is broadly expressed in the neuroectoderm of the embryo. Overexpression of ASPN causes the induction of ectopic eyes. By contrast, blocking ASPN function with a morpholino oligonucleotide (ASPN-MO) inhibits eye formation, indicating that ASPN is an essential factor for eye development. Detailed molecular analyses revealed that ASPN interacts with insulin growth factor receptor (IGFR) and is essential for activating the IGF receptor-mediated intracellular signalling pathway. Moreover, ASPN perturbed the Wnt, BMP and Activin signalling pathways, suggesting that ASPN thereby creates a favourable environment in which the IGF signal can dominate. ASPN is thus a novel secreted molecule essential for eye induction through the coordination of multiple signalling pathways.

MarvelD3 regulates the c-Jun N-terminal kinase pathway during eye development in Xenopus

“…X-gal staining and WISH were performed as described in Luehders et al (2015). Control (CT), Morpholino (MO) and MarvelD3 (MD3) MOs were purchased from Gene Tools (CT MO: CCTCTTACCTCAgTTACAATTTATA; MD3A MO: AGACCCAAATCTTCCTTTTGTTCCC; MD3B MO: CCCGTCTGTAACAGAATCTCTCATT).…”

Asporin Restricts Mesenchymal Stromal Cell Differentiation, Alters the Tumor Microenvironment, and Drives Metastatic Progression

“…How ASPN regulates MSC differentiation is not fully known. ASPN has been reported to regulate many extracellular signaling molecules (27,28,(49)(50)(51)(52), including multiple TGFb family members (26,27,49,(51)(52)(53). Most TGFb family members have pleiotropic and lineage-specific roles during differentiation; however, BMP-4 distinctly induces progenitor differentiation to osteoblast, adipocyte, and chondrocyte lineages (54).…”

A Deficiency in SUMOylation Activity Disrupts Multiple Pathways Leading to Neural Tube and Heart Defects inXenopusEmbryos

“…This disruption leads to improper patterning and phenotypes that include incomplete blastopore closure and shortened axis bnormalities, cleft face, and spina bifida [108,109], with the latter being a frequent phenotype in Gam1 embryos. While the disruption of Ets--1 (and Sp1) activity can account for the immediate effects on PDGF and its receptor, we note that there are also several downstream changes in gene expression that can contribute to the phenotypes of Gam1 embryos, including DUSP1 (cell 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 migration) [110] and IGF2 (neural and eye development) [111,112]. Of particular note, is the increased expression of the transcription factor Egr1 (late gastrula) which is a positive regulator of MyoD and a negative regulator of Xbra [113].…”