The surfactant lipid transporter ABCA3 is N‐terminally cleaved inside LAMP3‐positive vesicles

Abstract

a b s t r a c t ABCA3 mutations cause fatal surfactant deficiency and interstitial lung disease. ABCA3 protein is a lipid transporter indispensible for surfactant biogenesis and storage in lamellar bodies (LB). The protein folds in endoplasmic reticulum and is glycosylated in Golgi en route to the membrane of mature LB and their precursor multivesicular bodies (MVB). In immunoblots, C-terminally labeled ABCA3 appears as two protein bands of 150 and 190 kDa. Using N-and C-terminal protein tags and hindering ABCA3 processing we show that the 150 kDa protein represents the mature ABCA3 whose N-terminus is cleaved by a cysteine protease inside MVB/LB.

Disruption of N-linked glycosylation promotes proteasomal degradation of the human ATP-binding cassette transporter ABCA3

“…Treatment with PNGase F increased the electrophoretic mobility of the 220 kDa isoform, yielding a deglycosylated ϳ210-kDa ABCA3 product, whereas Endo H treatment resulted in partial deglycosylation of the protein, indicating that ABCA3 is modified with Endo H-insensitive complex sugar chains. In addition, we consistently detected a second GFP immunoreactive band with M r 180,000, previously demonstrated to represent a proteolytically cleaved ABCA3 isoform (17), that was insensitive to enzymatic treatment. The differential sensitivity of ABCA3 to PNGase F/Endo H profile of these isoforms is consistent with a model suggesting that this represents a processed product of ABCA3 generated by removal of the proximal NH 2 -terminal region (including N glycosylation sites) in post-Golgi, LAMP-3-positive compartments (17).…”

“…After synthesis of the primary translation product and translocation to the endoplasmic reticulum (ER), ABCA3 is routed via the early endosome/multivesicular body network directly to the LB in AT2 lung epithelial cells or to lysosomes and lysosomal-related organelles (LROs) in A549 and HEK293 cell lines (2,10,11,17,38,42,44). Within these distal compartments ABCA3 also undergoes posttranslational proteolysis of the proximal NH 2 -terminal region (17), which can be used as a biochemical marker of successful trafficking to distal vesicles. We have recently reported the identification of a novel xLxxKN targeting motif in the ABCA3 NH 2 -terminus that is also found in most other ABCA family members (4) and serves as a signal for their transit to post-Golgi compartments.…”

A large kindred of pulmonary fibrosis associated with a novel ABCA3 gene variant

“…pUB6-ABCA3 vectors were constructed as previously described [15]. The ABCA3-G964D point mutation was introduced into the pUB6-ABCA3-WT vector using the Quick Change Site-directed mutagenesis kit (Stratagene) with the following primers: G964D-for 5’- GCGAGTACGACAGAACCGTCGTG -3’ and G964D-rev 5’- CACGACGGTTCTGTCGTACTCGC -3’.…”

The biology of the ABCA3 lipid transporter in lung health and disease

“…Although the exact location remains to be specified, within post-Golgi compartments ABCA3 also undergoes posttranslational proteolysis at the proximal NH 2 -terminal region generating an ABCA3 product foreshortened by 30–40 kDa (Engelbrecht S et al, 2010). The underlying purpose behind this cleavage is yet to be elucidated since removal of such a large segment (~20% of the primary translation product and including up to three transmembrane domains) is likely to yield a profoundly altered structure of ABCA3 and to disrupt its function.…”