The tRNA processing enzyme RNase T is essential for maturation of 5S RNA.

Abstract

The maturation of 5S RNA in Escherichia coli is poorly understood. Although it is known that large precursors of 5S RNA accumulate in mutant cells lacking the endoribonuclease RNase E, almost nothing is known about how the mature 5' and 3' termini of these molecules are generated. We have examined 5S RNA Eight exoribonucleases that remove nucleotides in the 3' to 5' direction have been identified in E. coli (8, 9), and mutant strains lacking many of these enzymes, alone or in combination, are available (8, 10, 11). We have used these strains in combination with Northern blot analysis to address the question of whether any of these RNases might participate in the maturation of 5S RNA. Our results indicate that RNase T (12), an enzyme previously shown to participate in tRNA end turnover and tRNA processing (2), is required for maturation of the 3' terminus of 5S RNA. In the absence of RNase T, aThe publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.5S RNA molecule with 2 extra residues at its 3' end accumulates. Interestingly, cells containing this incompletely processed molecule and devoid of mature 5S RNA are nevertheless viable and grow only slightly slower than wild-type cells. MATERIALS AND METHODSBacterial Strains and Plasmids. E. coli K-12 strain CA244 (lacZ, trp, relA, spoT) (11) was considered wild type for these studies. Exoribonuclease-deficient derivatives of CA244 were constructed by P1 transduction as described (10,11,13 RNA Preparation. Cells were grown in YT medium to A550 1. Total RNA was isolated by phenol extraction as described (16). The RNA was used for analysis without further fractionation. rRNA was isolated from the ribosome fraction of cell extracts prepared as described (17). 5S RNA was purified from the total RNA of strain CA244 by gel filtration on Sephadex G-100.RNase T Treatment. Total RNA, 5S RNA, or ribosomes were treated with purified RNase T in 20 mM glycine-NaOH, pH 8.9/10 mM MgCl2/5 mM dithiothreitol. Samples were incubated at 37°C for various times and diluted immediately into ice-cold gel loading buffer containing 25 mM Tris HCl (pH 7.5), 0.5 mM EDTA (pH 8.0), 50% formamide, 0.1% xylene cyanol, and 0.1% bromphenol blue.Northern Blot Analysis. RNA samples, dissolved in gel loading buffer, were loaded on a 5% polyacrylamide/8.3 M urea sequencing gel. The gel was run at 1700 V until the xylene cyanol dye migrated 31 cm. The RNA was transferred to a GeneScreenPlus membrane (DuPont) by electroblotting. The RNA was hybridized with a chemically synthesized 22-mer deoxyoligonucleotide, GTTCGGCATGGGGTCAGGTGGG, complementary to residues 26-47 of 5S RNA, and labeled with 32P at its 5' end. The membrane was prehybridized at 42°C for 30 min in buffer containing 4x SSC, 0.5% SDS, lx Denhardt's solution, and 0.1 mg of denatured salmon sperm DNA per ml. Hybridization was carried out at 42°C overnight in the same buffer containing 0...

The Physiological Role of RNase T Can Be Explained by Its Unusual Substrate Specificity

“…M1 RNA terminates with a -CCU sequence, which also would be expected to be resistant to RNase T. The mature 3Ј-ends of 5 S and 23 S rRNAs terminate with either 1 or 2 unpaired U residues, respectively. Although these ends may afford some protection against further RNase T action, previous studies showed that assembly into the ribosome structure is a major determinant protecting the RNA (5,6). Based on these and other examples, it is clear that the unusual substrate specificity of RNase T is an important aspect of its function in vivo.…”

Exoribonuclease R in Pseudomonas syringae Is Essential for Growth at Low Temperature and Plays a Novel Role in the 3′ End Processing of 16 and 5 S Ribosomal RNA

“…Although RNase P generates the mature 5Ј end of tRNAs (31), RNase E and RNase G are responsible for generation of the 5Ј ends of mature 16 S rRNA (26). Maturation of 5 S rRNA on the other hand involves the activities of both RNase E and the exoribonuclease RNase T (32,33). RNase T is responsible for maturation of the 3Ј ends of both 23 and 5 S rRNA (34).…”

Identification of the gene encoding the 5S ribosomal RNA maturase in Bacillus subtilis: Mature 5S rRNA is dispensable for ribosome function

“…The mapping of a temperature-sensitive mutant with a defect in 5S rRNA processing, and thus accumulating a 9S precursor RNA, led to the identification of ribonuclease E in E. coli (Apirion & Lassar, 1978;Ghora & Apirion, 1978)+ RNase E cleaves 9S RNA in a singlestranded AU-rich region, 3 nt on either side of the mature 5S rRNA sequence (Ghora & Apirion, 1978)+ The 39 extension is subsequently trimmed by an exoribonuclease, RNase T (Li & Deutscher, 1995), whereas FIGURE 6. Alignment of RNase M5 proteins from different bacterial species+ Proteins were aligned using the Clustal X program+ Dark gray shading, marked with (*), indicates 100% identity; light gray shading, indicates 100% conservation of one of the strong, marked with (:), or weaker, marked with (+), families of amino acids, as defined by the Gonnet Pam250 matrix+ the enzyme involved in removal of the 59 extension is still unknown+ Proteins with homology to the first 500 amino acids (containing the active site) of E. coli RNase E are present in many organisms (Fig+ 7)+ In the beta and gamma subdivisions of the proteobacteria, which include the enterics, a second highly homologous endoribonuclease, CafA/RNase G, can be found in each species+ Indeed, CafA from some species is more homologous to the N-terminal domain of E. coli RNase E than full-length RNase E homologs of others+ Outside of the proteobacterial domain, one homolog is found, at most, per genome, and this protein generally shows equal homology to both RNase E and CafA+ Because of the ambiguity as to which of the two nucleases this protein is related to, it has been called "CafE" by some databases+ We suggest it be named RNase EG to reflect its role in RNA metabolism+ The vast majority of eubacteria possessing neither RNase E nor RNase EG, consisting primarily of the low G ϩ C Gram-positive group and Borrelia burgdorferi, have RNase M5 instead+ Interestingly, at least some members of the clostridial group, namely Clostridium acetobutylicum and Clostridium difficile, have both types of enzymes, whereas other organisms, particularly the archaebacterial group, have neither+ Presumably, yet other 5S maturation pathways exist in these bacteria+…”