The Ubiquitin Ligase RNF220 Enhances Canonical Wnt Signaling through USP7-Mediated Deubiquitination of β-Catenin

Ma, Ping; Yang, Xin; Kong, Qinghua; Li, Chaocui; Yang, Shimei; Li, Yan; Mao, Bingyu

doi:10.1128/mcb.00731-14

Cited by 85 publications

(82 citation statements)

References 41 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Thus, USP7 and Trip12 are mutual substrates for each other, and the balance between them would determine their effective levels to control their other target proteins, including those proteins involved in the DDR. We showed previously that USP7 interacts with RNF220, a RING domain ubiquitin ligase [16]. However, in that case, USP7 and RNF220 did not have a clear effect on each other's stability.…”

Section: Discussionmentioning

confidence: 79%

Trip12 is an E3 ubiquitin ligase for USP7/HAUSP involved in the DNA damage response

Liu

Yang

et al. 2016

FEBS Letters

Self Cite

View full text Add to dashboard Cite

The deubiquitinating enzyme, USP7/HAUSP (herpesvirus-associated ubiquitin-specific protease), is a key regulator of the tumor suppressor p53 and plays a major role in regulating genome stability. Here, we report that the protein stability of USP7 is regulated by the ubiquitin-proteasome pathway. We identified the thyroid hormone receptor interactor 12 (Trip12) as a ubiquitin E3 ligase for USP7. We also found that Trip12 affects USP7-mediated stabilization of p53 and the checkpoint proteins 53BP1 and Chk1. Knockdown of Trip12 leads to an increased cell population in G1 phase, mimicking USP7 overexpression. In contrast, Trip12 overexpression increased the number of cells in intra-S-phase, phenocopying the USP7 knockdown phenotype. Therefore, our data reveal an important modulatory role for Trip12 in the USP7-dependent DNA damage response.

show abstract

Section: Discussionmentioning

confidence: 79%

Trip12 is an E3 ubiquitin ligase for USP7/HAUSP involved in the DNA damage response

Liu

Yang

et al. 2016

FEBS Letters

Self Cite

View full text Add to dashboard Cite

show abstract

“…5C). Rnf220 is an E3 ubiquitin ligase with a RING finger domain that has been shown to stabilize b-catenin and, therefore, enhance canonical Wnt signaling (71). b-Catenin stabilization was shown to occur via deubiquitination by a complex of Rnf220 and the ubiquitinspecific protease 7 (71).…”

Section: Discussionmentioning

confidence: 99%

“…Rnf220 is an E3 ubiquitin ligase with a RING finger domain that has been shown to stabilize b-catenin and, therefore, enhance canonical Wnt signaling (71). b-Catenin stabilization was shown to occur via deubiquitination by a complex of Rnf220 and the ubiquitinspecific protease 7 (71). Promotion of Wnt/b-catenin signaling by canonical ligand, Wnt3a, and inhibition of Wnt antagonist, Dkk1, has been shown to decrease LPSinduced neutrophil influx and cytokine production (72).…”

Section: Discussionmentioning

confidence: 99%

Genetic determinants of susceptibility to silver nanoparticle‐induced acute lung inflammation in mice

et al. 2017

View full text Add to dashboard Cite

Silver nanoparticles (AgNPs) are employed in a variety of consumer products; however, rodent studies indicate that AgNPs can cause lung inflammation and toxicity in a strain- and particle type-dependent manner, but mechanisms of susceptibility remain unclear. The aim of this study was to assess the variation in AgNP-induced lung inflammation and toxicity across multiple inbred mouse strains and to use genome-wide association (GWA) mapping to identify potential candidate susceptibility genes. Mice received doses of 0.25 mg/kg of either 20-nm citrate-coated AgNPs or citrate buffer using oropharyngeal aspiration. Neutrophils in bronchoalveolar lavage fluid (BALF) served as markers of inflammation. We found significant strain- and treatment-dependent variation in neutrophils in BALF. GWA mapping identified 10 significant single-nucleotide polymorphisms (false discovery rate, 15%) in 4 quantitative trait loci on mouse chromosomes 1, 4, 15, and 18, and (neural precursor cell expressed developmentally downregulated gene 4-like; chromosome 18), (anocatmin 6; chromosome 15), and (Ring finger protein 220; chromosome 4) were considered candidate genes. Quantitative RT-PCR revealed significant inverse associations between mRNA levels of these genes and neutrophil influx. ,, and are candidate susceptibility genes for AgNP-induced lung inflammation that warrant additional exploration in future studies.-Scoville, D. K., Botta, D., Galdanes, K., Schmuck, S. C., White, C. C., Stapleton, P. L., Bammler, T. K., MacDonald, J. W., Altemeier, W. A., Hernandez, M., Kleeberger, S. R., Chen, L.-C., Gordon, T., Kavanagh, T. J. Genetic determinants of susceptibility to silver nanoparticle-induced acute lung inflammation in mice.

show abstract

“…11668019, Thermo Fisher Scientific). In Figure and , cells were transfected with siRNA for 48 h and further treated with P5091 for 48 h. In Figure , cells transfected with siRNAs were collected after 96 h. The sequences of the siRNA are as follows: siNOXA‐1 : GUAAUUAUUGACACAUUUC; siNOXA‐2: GGUGCACGUUUCAUCAAUUUG; siUSP7‐1: ACCCUUGGACAAUAUUCCU; siUSP7‐2: AGUCGUUCAGUCGUCGUAU; siUSP7‐3: UGACGUGUCUCUUGAUAAA; siATF4: GCCUAGGUCUCUUAGAUGA; siControl: UUCUCCGAACGUGUCACGU.…”

Section: Methodsmentioning

confidence: 99%

Targeting the overexpressed USP7 inhibits esophageal squamous cell carcinoma cell growth by inducing NOXA‐mediated apoptosis

Zhang

Sha

et al. 2018

Molecular Carcinogenesis

View full text Add to dashboard Cite

Increasing evidence suggests that deubiquitinase USP7 participates in tumor progression by various mechanisms and serves as a potential therapeutic target. However, its expression and role in esophageal cancer remains elusive; the anti-cancer effect by targeting USP7 still needs to be investigated. Here, we reported that USP7 was overexpressed in esophageal squamous cell carcinoma (ESCC) tissues compared with adjacent tissues, implying that USP7 was an attractive anticancer target of ESCC. Pharmaceutical or genetic inactivation of USP7 inhibited esophageal cancer cells growth in vitro and in vivo and induced apoptosis. Mechanistically, inhibition of USP7 accumulated poly-ubiquitinated proteins, activated endoplasmic reticulum stress, and increased expression of ATF4, which transcriptionally upregulated expression of NOXA and induced NOXA-mediated apoptosis. These results provide an evidence for clinical investigation of USP7 inhibitors for the treatment of ESCC.

show abstract

The Ubiquitin Ligase RNF220 Enhances Canonical Wnt Signaling through USP7-Mediated Deubiquitination of β-Catenin

Cited by 85 publications

References 41 publications

Trip12 is an E3 ubiquitin ligase for USP7/HAUSP involved in the DNA damage response

Trip12 is an E3 ubiquitin ligase for USP7/HAUSP involved in the DNA damage response

Genetic determinants of susceptibility to silver nanoparticle‐induced acute lung inflammation in mice

Targeting the overexpressed USP7 inhibits esophageal squamous cell carcinoma cell growth by inducing NOXA‐mediated apoptosis

Contact Info

Product

Resources

About