The Viral Origins of Telomeres and Telomerases and their Important Role in Eukaryogenesis and Genome Maintenance

Abstract

Whereas telomeres protect terminal ends of linear chromosomes, telomerases identify natural chromosome ends, which differ from broken DNA and replicate telomeres. Although telomeres play a crucial role in the linear chromosome organization of eukaryotic cells, their molecular syntax most probably descended from an ancient retroviral competence. This indicates an early retroviral colonization of large double-stranded DNA viruses, which are putative ancestors of the eukaryotic nucleus. This contribution demonstrates an advantage of the biosemiotic approach towards our evolutionary understanding of telomeres, telomerases, other reverse transcriptases and mobile elements. Their role in genetic/ genomic content organization and maintenance is no longer viewed as an object of randomly derived alterations (mutations) but as a highly sophisticated hierarchy of regulatory networks organized and coordinated by natural genome-editing competences of viruses.

Crucial steps to life: From chemical reactions to code using agents

“…Additionally we find this phenomenon in very conserved DNA genome content such as telomeres and centromeres (Witzany, 2008;Alliegro, 2011).…”

“…The abundance of retrovirus-derived LTRs are excellent examples of exapted gene regulation tools as are the Alu sequences of which we find a million copies within the human genome and are recently identified as key player to build up the nucleolus as important place for ribosomal subunit assembly (Carmo-Fonseca, 2015). Another excellent example are the telomere/telomerase tools for the genome maintenance and therefore for conservation of the whole genetic information of the cell which is reduced through the billion replications through ageing (Witzany, 2008). In all these examples genetic sequences of natural genome editors do something, with the result that they act as vital agents within cellular organisms.…”

Two Genetic Codes: Repetitive Syntax for Active non-Coding RNAs; non-Repetitive Syntax for the DNA Archives

“…72 For instance, we find TTAGGG in vertebrates, humans, mice, Xenopus, filamentous fungi, Neurospora crassa, the slime molds Physarum and Didymium: TTGGGG in Tetrahymena and Glaucoma; TTGGG(T/G) in Paramecium; TTTTGGGG in Oxytricha, Stylonychia and Euplotes; TTAGGG(T/C) in the apicomplexan protozoan Plasmodium; TTTAGGG in Arabidopsis thaliana; TTTTAGGG in green algae Chlamydomonas; TTAGG in the insect Bombyx mori; TTAGGC in the roundworm Ascaris lumbricoides; TGTGGGTGTGGTG (from RNA template) in Saccharomyces cerevisiae; GGGGTCTGGGTGCTG in Candida glabrata; and GGTGTACGGATGTCTAACTTCTT in Candida albicans. 73 The telomerase, a subspecies of the reverse transcriptase family, cares for telomere replication at the ends of chromosomes and, therefore, not only is a key player of genome maintenance but is also part of an immunity function that provides telomere ends from infection by genetic parasites. 73 This is a new role of a reverse transcriptase and demonstrates that RNA agents serve for both, infection of host genomes and-as coapted exaptations-as immune function against (related) infectious agents.…”

“…73 The telomerase, a subspecies of the reverse transcriptase family, cares for telomere replication at the ends of chromosomes and, therefore, not only is a key player of genome maintenance but is also part of an immunity function that provides telomere ends from infection by genetic parasites. 73 This is a new role of a reverse transcriptase and demonstrates that RNA agents serve for both, infection of host genomes and-as coapted exaptations-as immune function against (related) infectious agents. The evolutionary move from telomeres to centromeres in eukaryotes is an excellent example of re-invention of newly evolved features into another useful function.…”

Natural Genome Editing from a Biocommunicative Perspective

“…Long terminal repeats (LTRs) constitute compact nuclear structures like centromeres and the related telomeres (Blackburn 2000(Blackburn , 2006Witzany 2008). Repetitive genetic elements delineate centromeres and form telomeres by non-LTR-retroposons .…”