The Yeast HSM3 Gene Acts in One of the Mismatch Repair Pathways

Abstract

Mutants with enhanced spontaneous mutability (hsm) to canavanine resistance were induced by N-methyl-N-nitrosourea in Saccharomyces cerevisiae. One bearing the hsm3-1 mutation was used for this study. This mutation does not increase sensitivity to the lethal action of different mutagens. The hsm3-1 mutation produces a mutator phenotype, enhancing the rates of spontaneous mutation to canavanine resistance and reversions of lys1-1 and his1-7. This mutation increases the rate of intragenic mitotic recombination at the ADE2 gene. The ability of the hsm3 mutant to correct DNA heteroduplex is reduced in comparison with the wild-type strain. All these phenotypes are similar to ones caused by pms1, mlhl, and msh2 mutations. In contrast to these mutations, hsm3-1 increases the frequency of ade mutations induced by 6-HAP and UV light. Epistasis analysis of double mutants shows that the PMS1 and HSM3 genes control different mismatch repair systems. The HSM3 gene maps to the right arm of chromosome II, 25 cM distal to the HIS7 gene. Strains that bear a deleted open reading frame YBR272c have the genetic properties of the hsm3 mutant. The HSM3 product shows weak similarity to predicted products of the yeast MSH genes (homologs of the Escherichia coli mutS gene). The HSM3 gene may be a member of the yeast MutS homolog family, but its function in DNA metabolism differs from the functions of other yeast MutS homologs.

Genetic Analysis of the Hsm3 Protein Function in Yeast Saccharomyces cerevisiae NuB4 Complex

“…Earlier in our laboratory, extensive research was carried out on the genetic properties of hsm3∆ mutation [25][26][27][28][29][30][31]. We have shown that proteins Mms2, Xrs2, Srs2, Mph1, Mms4, involved in the error-free branch of the PRR, have a crucial function in hsm3-dependent UV mutagenesis [38,43].…”

“…Earlier, we have shown that mismatch repair plays a role in hsm3 -dependent mutagenesis [ 30 ]. The mutation frequency in hsm3Δ pms1Δ double mutant was significantly higher than in both single mutants.…”

“…Strains: S. cerevisiae strains used in this work are described in Table 1. The hat1∆ (CAY-2) and hif1∆ (CAY-3) mutants were obtained from the previously described LMG-3031 (MATα ade2∆-248 leu2-3,112 ura3-160,188 trp1) strain [30] by gene replacement. A PCR-generated natMX6 module and a PCR module containing the ura4 + gene from Schizosaccharomyces pombe were amplified from pFLA6A-natMX6 and pFLA6a-ura4 + plasmids (Latypov) using HAT1_DelL: 5 -cgaatttattagatttctatgtatttctacttgaagttaggaatagatctttctgg aattgttttcagcaaaattatgcttcgtacgctgcaggtcg-3 ; HAT1_DelR: 5 -atatcatcgatgaattcgagcgacaacata acggcttcaacctttgcataagcttatattaactatagagacactttgatgatcatctcgatgatg-3 ; and HIF1_DelL: 5 -atggggttacgtagtcgaaggatatagcagtgtctaaaaacttgcaagagcactcgtagcttcgtacgctgcaggtcg-3 ; HIF1_DelR: 5 -atatcatcgatgaattcgagctccttatgaatagagaaaaatg actttttttagatgtgtaagtatgtcatttcag ggatggtctgcttgctctttaaatattt-3 deoxyoligonucleotides, respectively.…”

“…The LMG-3031 strain was transformed with those modules, and the transformants were selected on plates with YEPD containing 30 mg/L nourseothricin and on plates with selective media without uracil respectively. The double hif1Δ hsm3Δ ( CAY-9 ) and hsm3Δ hat1Δ ( CAY-15 ) mutants were constructed from previously described 5-LMG-3031 ( MATα ade2Δ-248 leu2-3,112 ura3-160,188 trp1 hsm3::Kan R ) strain [ 30 ], as described above. The double hif1Δ hat1Δ ( CAY-11 ) and the triple hif1Δ hsm3Δ hat1Δ ( CAY-10 ) mutants were obtained by replacement of HAT1 gene in hif1Δ ( CAY-3 ) and hif1Δ hsm3Δ ( CAY-9 ) strains, according to the same procedure.…”

“…It was shown that NuB4 complex physically interacts with Hsm3p [22][23][24]. It was shown earlier that the gene HSM3 participates in the control of replicative and reparative spontaneous mutagenesis, and that hsm3∆ mutants increase the frequency of mutations induced by different mutagens [25][26][27][28][29][30][31]. It was previously believed that the HSM3 gene controlled only some minor repair processes in the cell, but later it was suggested that it had a chaperone function with its participation in proteasome assembly [32][33][34].…”