The zebrafish model of Tuberous sclerosis complex to study epilepsy

Hyperactive mTORC1 disrupts habenula function and light preference in zebrafish model of Tuberous sclerosis complex

“… RRID:ZFIN_ZDB-GENO-190115-9 Oligonucleotides Primer tsc2 for HRM genotyping, Forward: GAGACCTGCCTGGACATGAT Doszyn et al. 28 N/A Primer tsc2 for HRM genotyping, Reverse: CTTGGGCAGAGCAGAGAAGT Doszyn et al. 28 N/A Software and algorithms Fiji Schindelin et al.…”

“… 28 N/A Primer tsc2 for HRM genotyping, Reverse: CTTGGGCAGAGCAGAGAAGT Doszyn et al. 28 N/A Software and algorithms Fiji Schindelin et al. 29 https://fiji.sc/ R 4.3.2 R Foundation for Statistical Computing https://www.R-project.org RStudio Posit Software, PBC https://posit.co/download/rstudio-desktop/ ZebraLab version 3.22 ViewPoint Behavior Technology https://www.viewpoint.fr/product/zebrafish/fish-behavior-monitoring/zebralab ZEN2014 SP1 (black edition) Zeiss https://www.micro-shop.zeiss.com/en/us/softwarefinder/software-categories/zen-black Other Cokin CREATIVE light-absorbing photographic filters: Neutral grey ND4 – 0.6, Medium size Neutral grey ND8 – 0.9, Medium size Cokin Cat# P153 Cat# P154 Borosilicate glass capillaries 0.75 mm inner diameter Sutter Instruments Cat# BF150-75-10 Lightsheet Z.1 microscope Zeiss https://www.zeiss.com/microscopy/en/products/light-microscopes/light-sheet-microscopes.html ZebraBox ViewPoint Behavior Technology https://www.viewpoint.fr/product/zebrafish/fish-behavior-monitoring/zebrabox …”

“…The larvae were genotyped by PCR and high resolution melting technique using primers listed in the key resources table . 18 , 28 Genotyping was performed after collection of behavioral or imaging data in live experiments or after collection of zebrafish heads for immunofluorescence (the tails were used for genotyping). Offspring of at least two parental pairs were used in each experiment.…”