The Zinc Finger Antiviral Protein Directly Binds to Specific Viral mRNAs through the CCCH Zinc Finger Motifs

Abstract

The zinc finger antiviral protein (ZAP) is a recently isolated host antiviral factor. It specifically inhibits the replication of Moloney murine leukemia virus (MLV) and Sindbis virus (SIN) by preventing the accumulation of viral RNA in the cytoplasm. For this report, we mapped the viral sequences that are sensitive to ZAP inhibition. The viral sequences were cloned into a luciferase reporter and analyzed for the ability to mediate ZAP-dependent destabilization of the reporter. The sensitive sequence in MLV was mapped to the 3 long terminal repeat; the sensitive sequences in SIN were mapped to multiple fragments. The fragment of SIN that displayed the highest destabilizing activity was further analyzed by deletion mutagenesis for the minimal sequence that retained the activity. This led to the identification of a fragment of 653 nucleotides. Any further deletion of this fragment resulted in significantly lower activity. We provide evidence that ZAP directly binds to the active but not the inactive fragments. The CCCH zinc finger motifs of ZAP play important roles in RNA binding and antiviral activity. Disruption of the second and fourth zinc fingers abolished ZAP's activity, whereas disruption of the first and third fingers just slightly lowered its activity.The zinc finger antiviral protein (ZAP) was originally recovered from a screen for genes conferring resistance to the infection of cells by Moloney murine leukemia virus (MLV) (11). The overexpression of ZAP rendered cells 30-fold more resistant to viral infection. An analysis to determine the step at which ZAP blocked virus infection revealed that in ZAP-expressing cells, reverse transcription and nuclear entry of the viral DNA were normal but the production of viral RNA in the cytoplasm was inhibited (11). In addition to its inhibition of MLV, ZAP potently inhibits the replication of multiple members of the Alphavirus genus of the Togaviridae family, including Sindbis virus (SIN), Semliki Forest virus, Ross River virus, and Venezuelan equine encephalitis virus (3). The expression of ZAP does not induce a broad-spectrum antiviral state, as some viruses, including herpes simplex virus type 1 and yellow fever virus, grow normally in ZAP-expressing cells (3). ZAP targets SIN at a stage after binding and penetration, and it prevents translation of the incoming viral RNA (3). Given that alphaviruses are replicated entirely in an RNA state in the cytoplasm (19) and that the production of MLV viral RNA was inhibited only in the cytoplasm, it is tempting to propose that a common mechanism occurring in the cytoplasm underlies the ZAPmediated elimination of MLV and SIN viral RNAs. However, since there is no obvious sequence homology between MLV and SIN, the common feature(s) shared by these two divergent viruses to account for their sensitivity to ZAP remained elusive.Sequence analysis revealed that in the N terminus of ZAP there are four CCCH-type zinc finger motifs. A fragment of 254 amino acids of the N terminus (NZAP) containing the four zinc finger motifs displa...

Expression of YB-1 enhances production of murine leukemia virus vectors by stabilizing genomic viral RNA

“…MLV-luc is a retroviral vector carrying a firefly luciferase reporter (Gao et al, 2002;Guo et al, 2004). To produce VSV_G pseudotyped MLV-luc vector, pMLV-luc was cotransfected into HEK293T cells with pVSVG, a plasmid expressing VSV_G, and pHIT60, a plasmid expressing MLV proteins.…”

“…MLV-luc producing plasmids pCMV-VSVG, pHIT60 and pMA-Luc have been previously described (Gao et al, 2002;Guo et al, 2004).…”

“…YB-1FP: ATGCGGCCGCTATGAGCAGCGAGGCCGAGA YB-1RP: TA GCGGCCGCTTACTCAGCCCCGCCCTGC Reporters pGl3-5′LTR and pGl3-3′UTR, which contain the 5′LTR and 3′LTR of MLV, respectively, have been reported previously (Guo et al, 2004). Reporter pcDNA4-luc was constructed by inserting the coding sequence of firefly luciferase into pcDNA4/to/myc-HisB (Invitrogen) using the XhoI and SacII sites.…”

Cellular factors influencing Semliki Forest Virus vector biology

“…17,55,56 Furthermore, this protein also proved to exert a potent inhibitory effect on alphaviruses. Considering the exclusive cytoplasmic life cycle of the SFV, the nuclear-cytoplasm shuttling of ZAP might explain this observation.…”

Analyses of SELEX-derived ZAP-binding RNA aptamers suggest that the binding specificity is determined by both structure and sequence of the RNA

“…ZAP directly binds to specific viral mRNA sequences (Guo et al, 2004) and recruits the RNA processing exosome to degrade the target RNA (Guo et al, 2007). The RNA helicase p72 is required for optimal function of ZAP (Chen et al, 2008).…”