Thelephora dominicana (Basidiomycota, Thelephorales), a new species from the Dominican Republic, and preliminary notes on thelephoroid genera

Vizzini, Alfredo; Angelini, Claudio; Losi, Cristiano; Ercole, Enrico

doi:10.11646/phytotaxa.265.1.2

Cited by 20 publications

(29 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The results were in congruence with Baird et al (2013) with regard to overall tree topology and again the conclusion was that the limits of Sarcodon and Hydnellum need further study. A recent phylogenetic overview of Thelephorales (Vizzini et al 2016) and a study of Hydnellum from the Mediterranean region (Loizides et al 2016) came to similar conclusions, although Vizzini et al (2016) did not include sequences from several Neotropical Sarcodon species described by Grupe et al (2015, 2016).…”

Section: Introductionmentioning

confidence: 88%

Reassessment of the generic limits for Hydnellum and Sarcodon (Thelephorales, Basidiomycota)

Larsson¹,

Svantesson²,

Miscevic³

et al. 2019

View full text Add to dashboard Cite

DNA sequences from the nuclear LSU and ITS regions were used for phylogenetic analyses of Thelephorales with a focus on the stipitate hydnoid genera Hydnellum and Sarcodon. Analyses showed that Hydnellum and Sarcodon are distinct genera but that the current division, based on basidioma texture, makes Sarcodon paraphyletic with respect to Hydnellum. In order to make genera monophyletic several species are moved from Sarcodon to Hydnellum and the following new combinations are made: Hydnellumamygdaliolens, H.fennicum, H.fuligineoviolaceum, H.fuscoindicum, H.glaucopus, H.joeides, H.lepidum, H.lundellii, H.martioflavum, H.scabrosum, H.underwoodii, and H.versipelle. Basidiospore size seems to separate the genera in most cases. Hydnellum species have basidiospore lengths in the range 4.45−6.95 µm while the corresponding range for Sarcodon is 7.4−9 µm. S.quercinofibulatus deviates from this pattern with an average spore length around 6 µm. Neotropical Sarcodon species represent a separate evolutionary lineage.

show abstract

Section: Introductionmentioning

confidence: 88%

Reassessment of the generic limits for Hydnellum and Sarcodon (Thelephorales, Basidiomycota)

Larsson¹,

Svantesson²,

Miscevic³

et al. 2019

View full text Add to dashboard Cite

show abstract

“…The nuc rDNA ITS1-5.8S-ITS2 region (ITS) was amplified with the primers ITS1-F (5' CTTGGT-CATTTAGAGGAAGTAA 3') and ITS4 (5' TCCTCCGCTTATTGATATGC 3') (Baird et al 2013;Loizides et al 2016). The 28S nuclear rDNA region was amplified with the primers LROR (5' ACCCGCTGAACTTAAGC 3') and LR7 (5' TACTAC-CACCAAGATCT 3') (Vizzini et al 2016). The PCR thermal cycling programme conditions were set as follows: initial denaturation at 98 °C for 5 min, followed by 39 cycles at 98 °C for 30 s, × °C (the annealing temperatures for ITS1-F/ITS4 and LROR/LR7 were 57.2 °C and 47.2 °C, respectively) for 30 s, 72 °C for 30 s and a final extension at 72 °C for 1 min.…”

Section: Molecular Procedures and Phylogenetic Analysesmentioning

confidence: 99%

Hydnaceous fungi of China 8. Morphological and molecular identification of three new species of Sarcodon and a new record from southwest China

Mu¹,

Hu²,

Wei³

et al. 2020

View full text Add to dashboard Cite

Three new stipitate hydnoid fungi, Sarcodon coactus, S. grosselepidotus and S. lidongensis, are described and illustrated, based on morphological characteristics and nuc ITS rDNA + nuc LSU rDNA sequence analyses and a new record, S. leucopus, from China is reported. S. coactus is characterised by ellipsoid to round basidiocarps, reddish-brown to dark brown, felted pileal surface with white and incurved margins, simple-septate and partly short-celled generative hyphae and irregular subglobose, thin-walled, brown basidiospores with tuberculate ornamentation (tuberculi up to 1 μm long). S. grosselepidotus is characterised by infundibuliform to round, occasionally deeply fissured pileus, pale orange to dark ruby pileal surface with ascending and coarse scales, simple-septate generative hyphae and irregular ellipsoid to globose, thin-walled, brown basidiospores with tuberculate ornamentation (tuberculi up to 0.7 μm long). S. lidongensis is characterised by plano-convex to somewhat depressed and regular orbicular pileus, light brown to dark brown pileal surface with adhering squamose and purplish-brown, incurved and occasionally incised margin, cylindrical or broadened below stipe, simple-septate generative hyphae and irregular ellipsoid to subglobose, thin-walled basidiospores with tuberculate ornamentation (tuberculi up to 1 μm long). The absence of the clamp connection is the common morphological characteristic of these three new species; however, S. leucopus, a new record from China, has frequently clamped generative hyphae. Molecular analyses confirm the phylogenetic positions of three new and the new record species. The discriminating characters of these three new species and closely related species are discussed and a key to the species of Sarcodon from China is provided.

show abstract

“…Diversity 2021, 13, 646 2 of 22 and the genus is characterized by its diverse forms of basidiomycetes as stereoid, clavarioid, cantharelloid, spathulate, pleuropodally pileate to resupinate; hymenophore smooth to slightly wrinkled and often cyanescent in KOH; pileus surface glabrous to strigose, even or faintly ribbed or papillose; hymenium continuous, usually on inferior side, sometimes amphigenous in some species; hyphal system monomitic with clamped generative hyphae; basidia 4-spored; basidiospores subhyaline to brownish, ornamented, typically muricate, verruculose or echinulate, even or slightly rough-walled in a few species, and inamyloid [1,3,12,22]. As of 2008, fifty species of Thelephora have been accepted [23], and some new species have been reported in recent years [4,5,14,[24][25][26][27]. Index Fungorum [28] shows 871 specific and infraspecific names in Thelephora.…”

Section: Introductionmentioning

confidence: 99%

“…Index Fungorum [28] shows 871 specific and infraspecific names in Thelephora. However, to date, 62 species of Thelephora have been accepted [3][4][5]14,[23][24][25][26][27].…”

Section: Introductionmentioning

confidence: 99%

“…Based on phylogenetic analyses using rDNA internal transcribed spacer region (ITS) sequences showed that the species of Thelephora mixed with Tomentella, revealing that both genera are closely related, but it is well-known that the phylogenetic analyses of ITS loci are insufficient to resolve phylogenetic relationships among closely related taxa [4,5,31,32]. Based on ITS and nrLSU analyses, Vizzini et al [25] showed that Thelephora and Tomentella species do not separate to two monophyletic groups but they are intermixed and form a well-supported monophyletic clade (Thelephora/Tomentella clade). Back to traditional method, the most important characteristic for distinguishing Thelephora and Tomentella is the form of the basidiocarps (resupinate in Tomentella; erect, with varied forms, to partially resupinate in Thelephora) [24,29,33].…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Taxonomy and Phylogeny Reveal Two New Potential Edible Ectomycorrhizal Mushrooms of Thelephora from East Asia

Liu

Tibpromma²,

Xu³

et al. 2021

Diversity

View full text Add to dashboard Cite

The ectomycorrhizal basidiomycetes genus Thelephora has been understudied in subtropical ecosystems. Many species of Thelephora are important edible and medicinal fungi, with substantial economic value. Two new Thelephora species, T. grandinioides and T. wuliangshanensis spp. nov. are proposed here based on a combination of morphological features and molecular evidence. Thelephora grandinioides is characterized by laterally stipitate basidiocarps with a grandinoid hymenial surface, a monomitic hyphal system with clamped generative hyphae, and the presence of tubular and septated cystidia and subglobose to globose basidiospores measuring as 5.3–7.4 × 4–6.5 µm. Thelephora wuliangshanensis is characterized by infundibuliform basidiocarps, radially black striate on the pileus, a smooth, umber to coffee hymenial surface, a monomitic hyphal system with thick-walled generative hyphae, and basidiospores that turn greenish grey to buff in 5% KOH. Phylogenetic analyses of rDNA internal transcribed spacer region (ITS) and nuclear large subunit region (nrLSU) showed that the two new Thelephora are phylogenetically distinct: T. grandinioides is sister to T. aurantiotincta and T. sikkimensis, while T. wuliangshanensis is sister to a clade comprising T. austrosinensis and T. aurantiotincta with high support as well.

show abstract

Thelephora dominicana (Basidiomycota, Thelephorales), a new species from the Dominican Republic, and preliminary notes on thelephoroid genera

Cited by 20 publications

References 0 publications

Reassessment of the generic limits for Hydnellum and Sarcodon (Thelephorales, Basidiomycota)

Reassessment of the generic limits for Hydnellum and Sarcodon (Thelephorales, Basidiomycota)

Hydnaceous fungi of China 8. Morphological and molecular identification of three new species of Sarcodon and a new record from southwest China

Taxonomy and Phylogeny Reveal Two New Potential Edible Ectomycorrhizal Mushrooms of Thelephora from East Asia

Contact Info

Product

Resources

About