Thiostrepton inhibits the turnover but not the GTPase of elongation factor G on the ribosome

Abstract

The region around position 1067 in domain II of 23S rRNA frequently is referred to as the GTPase center of the ribosome. The notion is based on the observation that the binding of the antibiotic thiostrepton to this region inhibited GTP hydrolysis by elongation factor G (EF-G) on the ribosome at the conditions of multiple turnover. In the present work, we have reanalyzed the mechanism of action of thiostrepton. Results obtained by biochemical and fast kinetic techniques show that thiostrepton binding to the ribosome does not interfere with factor binding or with single-round GTP hydrolysis. Rather, the antibiotic inhibits the function of EF-G in subsequent steps, including release of inorganic phosphate from EF-G after GTP hydrolysis, tRNA translocation, and the dissociation of the factor from the ribosome, thereby inhibiting the turnover reaction. Structurally, thiostrepton interferes with EF-G footprints in the ␣-sarcin stem loop (A2660, A2662) located in domain VI of 23S rRNA. The results indicate that thiostrepton inhibits a structural transition of the 1067 region of 23S rRNA that is important for functions of EF-G after GTP hydrolysis.

Dissociation of Intact Escherichia coli Ribosomes in a Mass Spectrometer

“…Thiostrepton has been shown to block translocation even in the absence of EF-G (11) and recently under certain conditions to prevent complex formation (12). This is in contrast to a report where inhibition of phosphate ion and EF-G release from the ribosome was inferred (13). Biochemical studies have also revealed changes of conformation of the ribosome upon interaction with elongation factors, in particular protein L12 and its acetylated counterpart L7 (14,15).…”

The pathway to GTPase activation of elongation factor SelB on the ribosome

“…(IF1, IF2, IF3), and fMet-tRNA fMet were prepared as described [47][48][49] . E. coli SelA and SelD (gift from M. Wahl, Free University of Berlin) and SelB 50 containing a hexahistidine tag (gift from A. Böck, LMU Munich) were expressed in BL21(DE3) cells and purified according to published protocols 4,51 .…”

Structure of the E. coli ribosome–EF-Tu complex at <3 Å resolution by Cs-corrected cryo-EM

“…To obtain kirromycin-stalled E. coli ribosome-EF-Tu complexes, ribosomes from E. coli MRE 600, initiation factors (IF1, IF2, IF3), fMettRNA fMet , EF-Tu and Phe-tRNA Phe were prepared as described [31][32][33] . Prior to initiation, the mRNA (GGCAAGGAGGUAAAUAAUGUUCGUUACGAC; the AUG start codon coding for fMet and UUC coding for Phe are underlined) was incubated with 0.1 mM EDTA for 90 s at 80 uC and shock cooled in an ice-water bath.…”